EMAIL THIS PAGE TO A FRIEND

SYT2

synaptotagmin II

53 Gene Product Result for
Synonyms: SytII
UniProtKB ID: Q8N9I0, Q496K5, Q8NBE5
Gene ID:
Human(127833) Summary: Synaptotagmins, like SYT2, are integral membrane proteins of synaptic vesicles thought to serve as Ca(2+) sensors in the process of vesicular trafficking and exocytosis (Hilbush and Morgan, 1994 [PubMed 8058779]
Mouse(20980) synaptotagmin II
Rat(24805) synaptotagmin II
chicken(396327) synaptotagmin II
dog(607132) synaptotagmin II
domestic cat(101099015) synaptotagmin II
naked mole-rat(101714247) synaptotagmin II
cow(100300626) synaptotagmin II
sheep(101110609) synaptotagmin II
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009307 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009307 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009307 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_177402 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177402 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177402 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020031 MISSION® esiRNA esiRNA human SYT2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177402 Rosetta Predictions human pricing
NM_012665 Rosetta Predictions rat pricing
NM_009307 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202057 predicted 877
2 SASI_Hs01_00202058 predicted 772
3 SASI_Hs01_00202060 predicted 1484
4 SASI_Hs01_00202061 predicted 1476
5 SASI_Hs01_00202062 predicted 1187
6 SASI_Hs01_00202063 predicted 1493
7 SASI_Hs01_00202064 predicted 1156
8 SASI_Hs01_00202065 predicted 1503
9 SASI_Hs02_00369304 predicted 1449
10 SASI_Hs01_00202066 predicted 837
11 SASI_Hs01_00202059 predicted 1596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012665 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061152 predicted 353
2 SASI_Rn01_00061153 predicted 721
3 SASI_Rn01_00061154 predicted 745
4 SASI_Rn01_00061155 predicted 245
5 SASI_Rn01_00061156 predicted 719
6 SASI_Rn01_00061157 predicted 655
7 SASI_Rn01_00061158 predicted 834
8 SASI_Rn01_00061159 predicted 785
9 SASI_Rn01_00061160 predicted 307
10 SASI_Rn01_00061161 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009307 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107801 predicted 993
2 SASI_Mm01_00107802 predicted 1747
3 SASI_Mm01_00107803 predicted 1709
4 SASI_Mm01_00107804 predicted 1724
5 SASI_Mm01_00107805 predicted 397
6 SASI_Mm01_00107806 predicted 1745
7 SASI_Mm01_00107807 predicted 1620
8 SASI_Mm01_00107808 predicted 1730
9 SASI_Mm01_00107809 predicted 1034
10 SASI_Mm01_00107810 predicted 1100
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009307
SYT2 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin II
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009307.3-1052s21c1
Sequence:GTACCGGCCCTGGTGATGGCAATCTATGCTCGAGCATAGATTGCCATCACCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009307.3-625s21c1
Sequence:GTACCGGTGTTGCTTCTGCATCTGTAAGCTCGAGCTTACAGATGCAGAAGCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009307.3-799s21c1
Sequence:GTACCGGCCAGAGAACCTGGGCAAATTGCTCGAGCAATTTGCCCAGGTTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009307.3-2144s21c1
Sequence:GTACCGGTTTGAACATCTCTCTTCATTTCTCGAGAAATGAAGAGAGATGTTCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009307.2-994s1c1
Sequence:CCGGCCCAGCCTTCAATGAGACATTCTCGAGAATGTCTCATTGAAGGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009307.2-2528s1c1
Sequence:CCGGCCTAGAATTAAGCTCCTGGATCTCGAGATCCAGGAGCTTAATTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009307.2-943s1c1
Sequence:CCGGCCCAGACAAGAAGAAGAAATACTCGAGTATTTCTTCTTCTTGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009307.2-1463s1c1
Sequence:CCGGACCGTGCTAGACTACGACAAACTCGAGTTTGTCGTAGTCTAGCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009307.2-1058s1c1
Sequence:CCGGGTGATGGCAATCTATGACTTTCTCGAGAAAGTCATAGATTGCCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009307
SYT2 MISSION shRNA shRNA Plasmid DNA
synaptotagmin II
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009307.3-1052s21c1
Sequence:GTACCGGCCCTGGTGATGGCAATCTATGCTCGAGCATAGATTGCCATCACCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009307.3-625s21c1
Sequence:GTACCGGTGTTGCTTCTGCATCTGTAAGCTCGAGCTTACAGATGCAGAAGCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009307.3-799s21c1
Sequence:GTACCGGCCAGAGAACCTGGGCAAATTGCTCGAGCAATTTGCCCAGGTTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009307.3-2144s21c1
Sequence:GTACCGGTTTGAACATCTCTCTTCATTTCTCGAGAAATGAAGAGAGATGTTCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009307.2-994s1c1
Sequence:CCGGCCCAGCCTTCAATGAGACATTCTCGAGAATGTCTCATTGAAGGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009307.2-2528s1c1
Sequence:CCGGCCTAGAATTAAGCTCCTGGATCTCGAGATCCAGGAGCTTAATTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009307.2-943s1c1
Sequence:CCGGCCCAGACAAGAAGAAGAAATACTCGAGTATTTCTTCTTCTTGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009307.2-1463s1c1
Sequence:CCGGACCGTGCTAGACTACGACAAACTCGAGTTTGTCGTAGTCTAGCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009307.2-1058s1c1
Sequence:CCGGGTGATGGCAATCTATGACTTTCTCGAGAAAGTCATAGATTGCCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009307
SYT2 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin II
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009307.3-1052s21c1
Sequence:GTACCGGCCCTGGTGATGGCAATCTATGCTCGAGCATAGATTGCCATCACCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009307.3-625s21c1
Sequence:GTACCGGTGTTGCTTCTGCATCTGTAAGCTCGAGCTTACAGATGCAGAAGCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009307.3-799s21c1
Sequence:GTACCGGCCAGAGAACCTGGGCAAATTGCTCGAGCAATTTGCCCAGGTTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009307.3-2144s21c1
Sequence:GTACCGGTTTGAACATCTCTCTTCATTTCTCGAGAAATGAAGAGAGATGTTCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009307.2-994s1c1
Sequence:CCGGCCCAGCCTTCAATGAGACATTCTCGAGAATGTCTCATTGAAGGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009307.2-2528s1c1
Sequence:CCGGCCTAGAATTAAGCTCCTGGATCTCGAGATCCAGGAGCTTAATTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009307.2-943s1c1
Sequence:CCGGCCCAGACAAGAAGAAGAAATACTCGAGTATTTCTTCTTCTTGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009307.2-1463s1c1
Sequence:CCGGACCGTGCTAGACTACGACAAACTCGAGTTTGTCGTAGTCTAGCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009307.2-1058s1c1
Sequence:CCGGGTGATGGCAATCTATGACTTTCTCGAGAAAGTCATAGATTGCCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177402
SYT2 MISSION shRNA Bacterial Glycerol Stock
synaptotagmin II
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177402.4-1193s21c1
Sequence:GTACCGGTCAACGAGTCCTTCAGCTTTGCTCGAGCAAAGCTGAAGGACTCGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177402.4-1484s21c1
Sequence:CCGGCAAGATCCAGAGCTATCAATACTCGAGTATTGATAGCTCTGGATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177402.4-889s21c1
Sequence:CCGGGACATCATTGGAGAGGTAAAGCTCGAGCTTTACCTCTCCAATGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177402.4-845s21c1
Sequence:CCGGCTCTGGTGATGGCCATCTATGCTCGAGCATAGATGGCCATCACCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177402.x-523s1c1
Sequence:CCGGGATGACGACGACGCAGAGACACTCGAGTGTCTCTGCGTCGTCGTCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177402.4-422s21c1
Sequence:CCGGGCTTCTGCATCTGCAAGAAATCTCGAGATTTCTTGCAGATGCAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177402.4-318s21c1
Sequence:CCGGCAAACTGAAGGAGAAGTTATTCTCGAGAATAACTTCTCCTTCAGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177402.4-500s21c1
Sequence:GTACCGGTGAACATGAAGGACATGAAAGCTCGAGCTTTCATGTCCTTCATGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177402.x-1164s1c1
Sequence:CCGGGAAGAAGACCCTGAACCCATACTCGAGTATGGGTTCAGGGTCTTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177402.x-2350s1c1
Sequence:CCGGGAAGAAACAGAAGTCCCATTACTCGAGTAATGGGACTTCTGTTTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177402.x-1029s1c1
Sequence:CCGGCGGGAAGCTCACTGTCTGCATCTCGAGATGCAGACAGTGAGCTTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177402
SYT2 MISSION shRNA shRNA Plasmid DNA
synaptotagmin II
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177402.4-1193s21c1
Sequence:GTACCGGTCAACGAGTCCTTCAGCTTTGCTCGAGCAAAGCTGAAGGACTCGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177402.4-1484s21c1
Sequence:CCGGCAAGATCCAGAGCTATCAATACTCGAGTATTGATAGCTCTGGATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177402.4-889s21c1
Sequence:CCGGGACATCATTGGAGAGGTAAAGCTCGAGCTTTACCTCTCCAATGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177402.4-845s21c1
Sequence:CCGGCTCTGGTGATGGCCATCTATGCTCGAGCATAGATGGCCATCACCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177402.x-523s1c1
Sequence:CCGGGATGACGACGACGCAGAGACACTCGAGTGTCTCTGCGTCGTCGTCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177402.4-422s21c1
Sequence:CCGGGCTTCTGCATCTGCAAGAAATCTCGAGATTTCTTGCAGATGCAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177402.4-318s21c1
Sequence:CCGGCAAACTGAAGGAGAAGTTATTCTCGAGAATAACTTCTCCTTCAGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177402.4-500s21c1
Sequence:GTACCGGTGAACATGAAGGACATGAAAGCTCGAGCTTTCATGTCCTTCATGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177402.x-1164s1c1
Sequence:CCGGGAAGAAGACCCTGAACCCATACTCGAGTATGGGTTCAGGGTCTTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177402.x-2350s1c1
Sequence:CCGGGAAGAAACAGAAGTCCCATTACTCGAGTAATGGGACTTCTGTTTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177402.x-1029s1c1
Sequence:CCGGCGGGAAGCTCACTGTCTGCATCTCGAGATGCAGACAGTGAGCTTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177402
SYT2 MISSION shRNA Lentiviral Transduction Particles
synaptotagmin II
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177402.4-1193s21c1
Sequence:GTACCGGTCAACGAGTCCTTCAGCTTTGCTCGAGCAAAGCTGAAGGACTCGTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177402.4-1484s21c1
Sequence:CCGGCAAGATCCAGAGCTATCAATACTCGAGTATTGATAGCTCTGGATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177402.4-889s21c1
Sequence:CCGGGACATCATTGGAGAGGTAAAGCTCGAGCTTTACCTCTCCAATGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177402.4-845s21c1
Sequence:CCGGCTCTGGTGATGGCCATCTATGCTCGAGCATAGATGGCCATCACCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177402.x-523s1c1
Sequence:CCGGGATGACGACGACGCAGAGACACTCGAGTGTCTCTGCGTCGTCGTCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177402.4-422s21c1
Sequence:CCGGGCTTCTGCATCTGCAAGAAATCTCGAGATTTCTTGCAGATGCAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177402.4-318s21c1
Sequence:CCGGCAAACTGAAGGAGAAGTTATTCTCGAGAATAACTTCTCCTTCAGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177402.4-500s21c1
Sequence:GTACCGGTGAACATGAAGGACATGAAAGCTCGAGCTTTCATGTCCTTCATGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177402.x-1164s1c1
Sequence:CCGGGAAGAAGACCCTGAACCCATACTCGAGTATGGGTTCAGGGTCTTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177402.x-2350s1c1
Sequence:CCGGGAAGAAACAGAAGTCCCATTACTCGAGTAATGGGACTTCTGTTTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177402.x-1029s1c1
Sequence:CCGGCGGGAAGCTCACTGTCTGCATCTCGAGATGCAGACAGTGAGCTTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)