EMAIL THIS PAGE TO A FRIEND

TAAR8

trace amine associated receptor 8

21 Gene Product Result for
Synonyms: GPR102 TA5 TAR5 TRAR5 TaR-5 TaR-8
UniProtKB ID: Q969N4, Q5VUQ0
Gene ID:
cow(505001) trace amine associated receptor 8
cow(516101) trace amine associated receptor 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053278 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053278 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053278 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053278 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142621 predicted 556
2 SASI_Hs01_00142622 predicted 774
3 SASI_Hs01_00142624 predicted 780
4 SASI_Hs01_00142625 predicted 803
5 SASI_Hs01_00142626 predicted 604
6 SASI_Hs01_00142627 predicted 625
7 SASI_Hs02_00361913 predicted 658
8 SASI_Hs01_00142629 predicted 665
9 SASI_Hs01_00142630 predicted 525
10 SASI_Hs01_00142623 predicted 555
11 SASI_Hs01_00142628 predicted 428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053278
TAAR8 MISSION shRNA Bacterial Glycerol Stock
trace amine associated receptor 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053278.1-812s21c1
Sequence:CCGGTACCGTATACAGTTGATATATCTCGAGATATATCAACTGTATACGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053278.1-666s21c1
Sequence:CCGGAGCTAAACAACAAGCTATAAACTCGAGTTTATAGCTTGTTGTTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053278.1-33s1c1
Sequence:CCGGGCTTTGCTATGAGGATGTGAACTCGAGTTCACATCCTCATAGCAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053278.1-861s1c1
Sequence:CCGGCCCTGCCTATATCTATGAAATCTCGAGATTTCATAGATATAGGCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053278.1-785s1c1
Sequence:CCGGCGGTACTAGCATTTGTTATTTCTCGAGAAATAACAAATGCTAGTACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053278.1-560s1c1
Sequence:CCGGGTGGCTGTCAAATTATTGTAACTCGAGTTACAATAATTTGACAGCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053278.1-59s1c1
Sequence:CCGGCTTGTATTGAAACTCCCTATTCTCGAGAATAGGGAGTTTCAATACAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053278
TAAR8 MISSION shRNA shRNA Plasmid DNA
trace amine associated receptor 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053278.1-812s21c1
Sequence:CCGGTACCGTATACAGTTGATATATCTCGAGATATATCAACTGTATACGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053278.1-666s21c1
Sequence:CCGGAGCTAAACAACAAGCTATAAACTCGAGTTTATAGCTTGTTGTTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053278.1-33s1c1
Sequence:CCGGGCTTTGCTATGAGGATGTGAACTCGAGTTCACATCCTCATAGCAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053278.1-861s1c1
Sequence:CCGGCCCTGCCTATATCTATGAAATCTCGAGATTTCATAGATATAGGCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053278.1-785s1c1
Sequence:CCGGCGGTACTAGCATTTGTTATTTCTCGAGAAATAACAAATGCTAGTACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053278.1-560s1c1
Sequence:CCGGGTGGCTGTCAAATTATTGTAACTCGAGTTACAATAATTTGACAGCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053278.1-59s1c1
Sequence:CCGGCTTGTATTGAAACTCCCTATTCTCGAGAATAGGGAGTTTCAATACAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053278
TAAR8 MISSION shRNA Lentiviral Transduction Particles
trace amine associated receptor 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053278.1-812s21c1
Sequence:CCGGTACCGTATACAGTTGATATATCTCGAGATATATCAACTGTATACGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053278.1-666s21c1
Sequence:CCGGAGCTAAACAACAAGCTATAAACTCGAGTTTATAGCTTGTTGTTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053278.1-33s1c1
Sequence:CCGGGCTTTGCTATGAGGATGTGAACTCGAGTTCACATCCTCATAGCAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053278.1-861s1c1
Sequence:CCGGCCCTGCCTATATCTATGAAATCTCGAGATTTCATAGATATAGGCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053278.1-785s1c1
Sequence:CCGGCGGTACTAGCATTTGTTATTTCTCGAGAAATAACAAATGCTAGTACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053278.1-560s1c1
Sequence:CCGGGTGGCTGTCAAATTATTGTAACTCGAGTTACAATAATTTGACAGCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053278.1-59s1c1
Sequence:CCGGCTTGTATTGAAACTCCCTATTCTCGAGAATAGGGAGTTTCAATACAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)