EMAIL THIS PAGE TO A FRIEND

TAMM41

TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)

50 Gene Product Result for
Synonyms: C3orf31 RAM41 TAM41
UniProtKB ID: Q96BW9
Gene ID:
Mouse(68971) TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)
Rat(362419) TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)
cow(514330) TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)
sheep(101108084) TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)
domestic guinea pig(100725702) TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)
naked mole-rat(101712188) TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)
Zebrafish(641323) TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)
chicken(427581) TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)
domestic cat(101094247) TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)
dog(476532) TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138807 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138807 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138807 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026894 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026894 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026894 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138807 Rosetta Predictions human pricing
NM_001108642 Rosetta Predictions rat pricing
NM_026894 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363966 predicted 556
2 SASI_Hs01_00049935 predicted 581
3 SASI_Hs01_00049936 predicted 1000
4 SASI_Hs01_00049937 predicted 542
5 SASI_Hs02_00363967 predicted 616
6 SASI_Hs01_00049938 predicted 685
7 SASI_Hs01_00049939 predicted 476
8 SASI_Hs01_00049940 predicted 786
9 SASI_Hs01_00049941 predicted 964
10 SASI_Hs01_00049942 predicted 385
11 SASI_Hs01_00049934 predicted 526
12 SASI_Hs01_00049943 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108642 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240639 predicted 833
2 SASI_Rn02_00240640 predicted 757
3 SASI_Rn02_00240641 predicted 818
4 SASI_Rn02_00240642 predicted 714
5 SASI_Rn02_00240643 predicted 850
6 SASI_Rn02_00240644 predicted 497
7 SASI_Rn02_00240645 predicted 637
8 SASI_Rn02_00240646 predicted 456
9 SASI_Rn02_00240647 predicted 683
10 SASI_Rn02_00240648 predicted 731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026894 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082995 predicted 608
2 SASI_Mm01_00082996 predicted 261
3 SASI_Mm01_00082997 predicted 387
4 SASI_Mm01_00082998 predicted 448
5 SASI_Mm01_00082999 predicted 731
6 SASI_Mm02_00331166 predicted 224
7 SASI_Mm01_00083001 predicted 603
8 SASI_Mm01_00083002 predicted 815
9 SASI_Mm01_00083003 predicted 224
10 SASI_Mm01_00083004 predicted 378
11 SASI_Mm01_00083000 predicted 833
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138807
VALIDATED
TAMM41 MISSION shRNA Bacterial Glycerol Stock
TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138807.2-550s21c1
Sequence:CCGGGTAATGGTAGGCTTATCAAATCTCGAGATTTGATAAGCCTACCATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138807.2-859s21c1
Sequence:CCGGAGCCCAATATAGCCCACTTTCCTCGAGGAAAGTGGGCTATATTGGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138807.2-1062s1c1
Sequence:CCGGGAAACTTTATTCCAAGTGGCTCTCGAGAGCCACTTGGAATAAAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138807.2-765s1c1
Sequence:CCGGGAAGACCTCTTCATAGAGATTCTCGAGAATCTCTATGAAGAGGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_138807.2-390s1c1
Sequence:CCGGGACTTTGTGTTCACAGTAGATCTCGAGATCTACTGTGAACACAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138807.2-387s1c1
Sequence:CCGGCTGGACTTTGTGTTCACAGTACTCGAGTACTGTGAACACAAAGTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138807.2-494s1c1
Sequence:CCGGCACGTCCATCCAGAATAACTACTCGAGTAGTTATTCTGGATGGACGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138807.2-607s21c1
Sequence:CCGGTCCTCAACTGGAATAACTTATCTCGAGATAAGTTATTCCAGTTGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138807.2-517s21c1
Sequence:CCGGGCGCTGGAGTTTACTACAATTCTCGAGAATTGTAGTAAACTCCAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_138807.2-374s1c1
Sequence:CCGGGAAGAATGCTATGCTGGACTTCTCGAGAAGTCCAGCATAGCATTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138807.2-690s21c1
Sequence:CCGGAGATCAGCCCTCGATAGAAATCTCGAGATTTCTATCGAGGGCTGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_138807.2-425s1c1
Sequence:CCGGGCATTCAAAGAACCTGAAGAACTCGAGTTCTTCAGGTTCTTTGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138807.2-313s21c1
Sequence:CCGGTGAGTCTGGCTTTCGTCTACGCTCGAGCGTAGACGAAAGCCAGACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138807.2-661s21c1
Sequence:CCGGTTATCTCAGTGAACGAGGATGCTCGAGCATCCTCGTTCACTGAGATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138807
VALIDATED
TAMM41 MISSION shRNA shRNA Plasmid DNA
TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138807.2-550s21c1
Sequence:CCGGGTAATGGTAGGCTTATCAAATCTCGAGATTTGATAAGCCTACCATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138807.2-859s21c1
Sequence:CCGGAGCCCAATATAGCCCACTTTCCTCGAGGAAAGTGGGCTATATTGGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138807.2-1062s1c1
Sequence:CCGGGAAACTTTATTCCAAGTGGCTCTCGAGAGCCACTTGGAATAAAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138807.2-765s1c1
Sequence:CCGGGAAGACCTCTTCATAGAGATTCTCGAGAATCTCTATGAAGAGGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_138807.2-390s1c1
Sequence:CCGGGACTTTGTGTTCACAGTAGATCTCGAGATCTACTGTGAACACAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138807.2-387s1c1
Sequence:CCGGCTGGACTTTGTGTTCACAGTACTCGAGTACTGTGAACACAAAGTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138807.2-494s1c1
Sequence:CCGGCACGTCCATCCAGAATAACTACTCGAGTAGTTATTCTGGATGGACGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138807.2-607s21c1
Sequence:CCGGTCCTCAACTGGAATAACTTATCTCGAGATAAGTTATTCCAGTTGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138807.2-517s21c1
Sequence:CCGGGCGCTGGAGTTTACTACAATTCTCGAGAATTGTAGTAAACTCCAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_138807.2-374s1c1
Sequence:CCGGGAAGAATGCTATGCTGGACTTCTCGAGAAGTCCAGCATAGCATTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138807.2-690s21c1
Sequence:CCGGAGATCAGCCCTCGATAGAAATCTCGAGATTTCTATCGAGGGCTGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_138807.2-425s1c1
Sequence:CCGGGCATTCAAAGAACCTGAAGAACTCGAGTTCTTCAGGTTCTTTGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138807.2-313s21c1
Sequence:CCGGTGAGTCTGGCTTTCGTCTACGCTCGAGCGTAGACGAAAGCCAGACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138807.2-661s21c1
Sequence:CCGGTTATCTCAGTGAACGAGGATGCTCGAGCATCCTCGTTCACTGAGATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138807
VALIDATED
TAMM41 MISSION shRNA Lentiviral Transduction Particles
TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138807.2-550s21c1
Sequence:CCGGGTAATGGTAGGCTTATCAAATCTCGAGATTTGATAAGCCTACCATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138807.2-859s21c1
Sequence:CCGGAGCCCAATATAGCCCACTTTCCTCGAGGAAAGTGGGCTATATTGGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138807.2-1062s1c1
Sequence:CCGGGAAACTTTATTCCAAGTGGCTCTCGAGAGCCACTTGGAATAAAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138807.2-765s1c1
Sequence:CCGGGAAGACCTCTTCATAGAGATTCTCGAGAATCTCTATGAAGAGGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_138807.2-390s1c1
Sequence:CCGGGACTTTGTGTTCACAGTAGATCTCGAGATCTACTGTGAACACAAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138807.2-387s1c1
Sequence:CCGGCTGGACTTTGTGTTCACAGTACTCGAGTACTGTGAACACAAAGTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138807.2-494s1c1
Sequence:CCGGCACGTCCATCCAGAATAACTACTCGAGTAGTTATTCTGGATGGACGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138807.2-607s21c1
Sequence:CCGGTCCTCAACTGGAATAACTTATCTCGAGATAAGTTATTCCAGTTGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138807.2-517s21c1
Sequence:CCGGGCGCTGGAGTTTACTACAATTCTCGAGAATTGTAGTAAACTCCAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_138807.2-374s1c1
Sequence:CCGGGAAGAATGCTATGCTGGACTTCTCGAGAAGTCCAGCATAGCATTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138807.2-690s21c1
Sequence:CCGGAGATCAGCCCTCGATAGAAATCTCGAGATTTCTATCGAGGGCTGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_138807.2-425s1c1
Sequence:CCGGGCATTCAAAGAACCTGAAGAACTCGAGTTCTTCAGGTTCTTTGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138807.2-313s21c1
Sequence:CCGGTGAGTCTGGCTTTCGTCTACGCTCGAGCGTAGACGAAAGCCAGACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138807.2-661s21c1
Sequence:CCGGTTATCTCAGTGAACGAGGATGCTCGAGCATCCTCGTTCACTGAGATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026894
VALIDATED
TAMM41 MISSION shRNA Bacterial Glycerol Stock
TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026894.1-342s1c1
Sequence:CCGGCTCCTCCATCCAGAATAATTACTCGAGTAATTATTCTGGATGGAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026894.1-957s1c1
Sequence:CCGGGCGACTAGCGATCTCATCAATCTCGAGATTGATGAGATCGCTAGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026894.1-784s1c1
Sequence:CCGGCAAGGCCAACTGGAGATAGATCTCGAGATCTATCTCCAGTTGGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026894.1-519s1c1
Sequence:CCGGGAATGAGAACATGGCTCTTAGCTCGAGCTAAGAGCCATGTTCTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026894.1-585s1c1
Sequence:CCGGCCTCATGCTACCTGAAAGCTTCTCGAGAAGCTTTCAGGTAGCATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026894.1-223s1c1
Sequence:CCGGGAGAATCCCATGTTAGACTTACTCGAGTAAGTCTAACATGGGATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026894
VALIDATED
TAMM41 MISSION shRNA shRNA Plasmid DNA
TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026894.1-342s1c1
Sequence:CCGGCTCCTCCATCCAGAATAATTACTCGAGTAATTATTCTGGATGGAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026894.1-957s1c1
Sequence:CCGGGCGACTAGCGATCTCATCAATCTCGAGATTGATGAGATCGCTAGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026894.1-784s1c1
Sequence:CCGGCAAGGCCAACTGGAGATAGATCTCGAGATCTATCTCCAGTTGGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026894.1-519s1c1
Sequence:CCGGGAATGAGAACATGGCTCTTAGCTCGAGCTAAGAGCCATGTTCTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026894.1-585s1c1
Sequence:CCGGCCTCATGCTACCTGAAAGCTTCTCGAGAAGCTTTCAGGTAGCATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026894.1-223s1c1
Sequence:CCGGGAGAATCCCATGTTAGACTTACTCGAGTAAGTCTAACATGGGATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026894
VALIDATED
TAMM41 MISSION shRNA Lentiviral Transduction Particles
TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026894.1-342s1c1
Sequence:CCGGCTCCTCCATCCAGAATAATTACTCGAGTAATTATTCTGGATGGAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026894.1-957s1c1
Sequence:CCGGGCGACTAGCGATCTCATCAATCTCGAGATTGATGAGATCGCTAGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026894.1-784s1c1
Sequence:CCGGCAAGGCCAACTGGAGATAGATCTCGAGATCTATCTCCAGTTGGCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026894.1-519s1c1
Sequence:CCGGGAATGAGAACATGGCTCTTAGCTCGAGCTAAGAGCCATGTTCTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026894.1-585s1c1
Sequence:CCGGCCTCATGCTACCTGAAAGCTTCTCGAGAAGCTTTCAGGTAGCATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026894.1-223s1c1
Sequence:CCGGGAGAATCCCATGTTAGACTTACTCGAGTAAGTCTAACATGGGATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)