EMAIL THIS PAGE TO A FRIEND

TAS2R4

taste receptor, type 2, member 4

17 Gene Product Result for
Synonyms: T2R4
UniProtKB ID: Q9NYW5, Q645W5, Q75MV8
Gene ID:
Human(50832) Summary: This gene encodes a member of a family of candidate taste receptors that are members of the G protein-coupled receptor superfamily and that are specifically expressed by taste receptor cells of the tongue and palate epithelia. These apparently intronless genes encode a 7-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is clustered with another 3 candidate taste receptor genes in chromosome 7 and is genetically linked to loci that influence bitter perception. [provided by RefSeq, Jul 2008]
dog(100688996) taste receptor, type 2, member 4
cow(664648) taste receptor, type 2, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016944 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016944 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016944 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019061 MISSION® esiRNA esiRNA targeting human TAS2R4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016944 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349945 predicted 579
2 SASI_Hs01_00106866 predicted 303
3 SASI_Hs01_00106867 predicted 595
4 SASI_Hs01_00106869 predicted 674
5 SASI_Hs01_00106870 predicted 484
6 SASI_Hs01_00106871 predicted 481
7 SASI_Hs01_00106872 predicted 466
8 SASI_Hs01_00106873 predicted 595
9 SASI_Hs01_00106874 predicted 466
10 SASI_Hs01_00106875 predicted 553
11 SASI_Hs01_00106868 predicted 556
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016944
TAS2R4 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016944.1-705s1c1
Sequence:CCGGCCTCATCCTCTACATTCCATACTCGAGTATGGAATGTAGAGGATGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016944.1-206s1c1
Sequence:CCGGTCGTCTCTTCAAATACGGAAACTCGAGTTTCCGTATTTGAAGAGACGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016944.1-682s1c1
Sequence:CCGGGCTATGAAGCTGATGGTCTATCTCGAGATAGACCATCAGCTTCATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016944.1-518s1c1
Sequence:CCGGGCATCTTGTCTTTAGTGGTTTCTCGAGAAACCACTAAAGACAAGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016944.1-482s1c1
Sequence:CCGGCTACGAGAAATAACACATCATCTCGAGATGATGTGTTATTTCTCGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016944.1-354s21c1
Sequence:CCGGTCTCCTGCTGAAGCGGAATATCTCGAGATATTCCGCTTCAGCAGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016944.1-683s21c1
Sequence:CCGGCTATGAAGCTGATGGTCTATTCTCGAGAATAGACCATCAGCTTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016944.1-167s21c1
Sequence:CCGGTTCTTATGCTGGGACTATTTCCTCGAGGAAATAGTCCCAGCATAAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016944.1-472s21c1
Sequence:CCGGGAACTTGTGACTACGAGAAATCTCGAGATTTCTCGTAGTCACAAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016944
TAS2R4 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016944.1-705s1c1
Sequence:CCGGCCTCATCCTCTACATTCCATACTCGAGTATGGAATGTAGAGGATGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016944.1-206s1c1
Sequence:CCGGTCGTCTCTTCAAATACGGAAACTCGAGTTTCCGTATTTGAAGAGACGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016944.1-682s1c1
Sequence:CCGGGCTATGAAGCTGATGGTCTATCTCGAGATAGACCATCAGCTTCATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016944.1-518s1c1
Sequence:CCGGGCATCTTGTCTTTAGTGGTTTCTCGAGAAACCACTAAAGACAAGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016944.1-482s1c1
Sequence:CCGGCTACGAGAAATAACACATCATCTCGAGATGATGTGTTATTTCTCGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016944.1-354s21c1
Sequence:CCGGTCTCCTGCTGAAGCGGAATATCTCGAGATATTCCGCTTCAGCAGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016944.1-683s21c1
Sequence:CCGGCTATGAAGCTGATGGTCTATTCTCGAGAATAGACCATCAGCTTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016944.1-167s21c1
Sequence:CCGGTTCTTATGCTGGGACTATTTCCTCGAGGAAATAGTCCCAGCATAAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016944.1-472s21c1
Sequence:CCGGGAACTTGTGACTACGAGAAATCTCGAGATTTCTCGTAGTCACAAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016944
TAS2R4 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016944.1-705s1c1
Sequence:CCGGCCTCATCCTCTACATTCCATACTCGAGTATGGAATGTAGAGGATGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016944.1-206s1c1
Sequence:CCGGTCGTCTCTTCAAATACGGAAACTCGAGTTTCCGTATTTGAAGAGACGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016944.1-682s1c1
Sequence:CCGGGCTATGAAGCTGATGGTCTATCTCGAGATAGACCATCAGCTTCATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016944.1-518s1c1
Sequence:CCGGGCATCTTGTCTTTAGTGGTTTCTCGAGAAACCACTAAAGACAAGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016944.1-482s1c1
Sequence:CCGGCTACGAGAAATAACACATCATCTCGAGATGATGTGTTATTTCTCGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016944.1-354s21c1
Sequence:CCGGTCTCCTGCTGAAGCGGAATATCTCGAGATATTCCGCTTCAGCAGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016944.1-683s21c1
Sequence:CCGGCTATGAAGCTGATGGTCTATTCTCGAGAATAGACCATCAGCTTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016944.1-167s21c1
Sequence:CCGGTTCTTATGCTGGGACTATTTCCTCGAGGAAATAGTCCCAGCATAAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016944.1-472s21c1
Sequence:CCGGGAACTTGTGACTACGAGAAATCTCGAGATTTCTCGTAGTCACAAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)