EMAIL THIS PAGE TO A FRIEND

TAS2R7

taste receptor, type 2, member 7

20 Gene Product Result for
Synonyms: T2R7 TRB4
UniProtKB ID: Q9NYW3, Q645Y1
Gene ID:
Human(50837) Summary: This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
chicken(771663) taste receptor, type 2, member 7
dog(100271739) taste receptor, type 2, member 7
cow(100300284) taste receptor, type 2, member 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304613 ANTI-TAS2R7 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4502086 Anti-TAS2R7 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023919 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023919 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023919 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049001 MISSION® esiRNA esiRNA human TAS2R7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023919 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143525 predicted 204
2 SASI_Hs01_00143526 predicted 585
3 SASI_Hs01_00143527 predicted 355
4 SASI_Hs01_00143528 predicted 729
5 SASI_Hs02_00356373 predicted 356
6 SASI_Hs01_00143529 predicted 493
7 SASI_Hs02_00356374 predicted 556
8 SASI_Hs01_00143530 predicted 786
9 SASI_Hs01_00143533 predicted 674
10 SASI_Hs01_00143534 predicted 218
11 SASI_Hs01_00143531 predicted 594
12 SASI_Hs01_00143532 predicted 475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023919
TAS2R7 MISSION shRNA Bacterial Glycerol Stock
taste receptor, type 2, member 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023919.1-726s1c1
Sequence:CCGGCCTCTTTATTGCCTACTATTTCTCGAGAAATAGTAGGCAATAAAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023919.1-411s1c1
Sequence:CCGGCGTGGTTCTCTCTGTGTTTATCTCGAGATAAACACAGAGAGAACCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023919.1-155s1c1
Sequence:CCGGCCATATCCAGAATTTGTCTATCTCGAGATAGACAAATTCTGGATATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023919.1-624s1c1
Sequence:CCGGGCGGAGACATATCAGGCGAATCTCGAGATTCGCCTGATATGTCTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023919.1-230s1c1
Sequence:CCGGCCACTGGTAAAGAAATGAGAACTCGAGTTCTCATTTCTTTACCAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023919.2-129s21c1
Sequence:CCGGTGCATTCATTGGATTGGTAAACTCGAGTTTACCAATCCAATGAATGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023919.2-591s21c1
Sequence:CCGGACATGCTTCTACCAAGTTATTCTCGAGAATAACTTGGTAGAAGCATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023919.2-504s21c1
Sequence:CCGGTGAGAATTTGAACGCTGATTTCTCGAGAAATCAGCGTTCAAATTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023919
TAS2R7 MISSION shRNA shRNA Plasmid DNA
taste receptor, type 2, member 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023919.1-726s1c1
Sequence:CCGGCCTCTTTATTGCCTACTATTTCTCGAGAAATAGTAGGCAATAAAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023919.1-411s1c1
Sequence:CCGGCGTGGTTCTCTCTGTGTTTATCTCGAGATAAACACAGAGAGAACCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023919.1-155s1c1
Sequence:CCGGCCATATCCAGAATTTGTCTATCTCGAGATAGACAAATTCTGGATATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023919.1-624s1c1
Sequence:CCGGGCGGAGACATATCAGGCGAATCTCGAGATTCGCCTGATATGTCTCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023919.1-230s1c1
Sequence:CCGGCCACTGGTAAAGAAATGAGAACTCGAGTTCTCATTTCTTTACCAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023919.2-129s21c1
Sequence:CCGGTGCATTCATTGGATTGGTAAACTCGAGTTTACCAATCCAATGAATGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023919.2-591s21c1
Sequence:CCGGACATGCTTCTACCAAGTTATTCTCGAGAATAACTTGGTAGAAGCATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023919.2-504s21c1
Sequence:CCGGTGAGAATTTGAACGCTGATTTCTCGAGAAATCAGCGTTCAAATTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023919
TAS2R7 MISSION shRNA Lentiviral Transduction Particles
taste receptor, type 2, member 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023919.1-726s1c1
Sequence:CCGGCCTCTTTATTGCCTACTATTTCTCGAGAAATAGTAGGCAATAAAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023919.1-411s1c1
Sequence:CCGGCGTGGTTCTCTCTGTGTTTATCTCGAGATAAACACAGAGAGAACCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023919.1-155s1c1
Sequence:CCGGCCATATCCAGAATTTGTCTATCTCGAGATAGACAAATTCTGGATATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023919.1-624s1c1
Sequence:CCGGGCGGAGACATATCAGGCGAATCTCGAGATTCGCCTGATATGTCTCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023919.1-230s1c1
Sequence:CCGGCCACTGGTAAAGAAATGAGAACTCGAGTTCTCATTTCTTTACCAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023919.2-129s21c1
Sequence:CCGGTGCATTCATTGGATTGGTAAACTCGAGTTTACCAATCCAATGAATGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023919.2-591s21c1
Sequence:CCGGACATGCTTCTACCAAGTTATTCTCGAGAATAACTTGGTAGAAGCATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023919.2-504s21c1
Sequence:CCGGTGAGAATTTGAACGCTGATTTCTCGAGAAATCAGCGTTCAAATTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)