EMAIL THIS PAGE TO A FRIEND

TAX1BP3

Tax1 (human T-cell leukemia virus type I) binding protein 3

80 Gene Product Result for
Synonyms: TIP-1
UniProtKB ID: O14907, B2RD53, D3DTJ6, Q7LCQ4
Gene ID:
Mouse(76281) Tax1 (human T cell leukemia virus type I) binding protein 3
Rat(360564) Tax1 (human T-cell leukemia virus type I) binding protein 3
Zebrafish(406779) Tax1 (human T-cell leukemia virus type I) binding protein 3
dog(491221) Tax1 (human T-cell leukemia virus type I) binding protein 3
domestic cat(101092715) Tax1 (human T-cell leukemia virus type I) binding protein 3
chicken(417605) Tax1 (human T-cell leukemia virus type I) binding protein 3
naked mole-rat(101721760) Tax1 (human T-cell leukemia virus type I) binding protein 3
domestic guinea pig(100729076) Tax1 (human T-cell leukemia virus type I) binding protein 3
cow(514852) Tax1 (human T-cell leukemia virus type I) binding protein 3
sheep(101122958) Tax1 (human T-cell leukemia virus type I) binding protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029564 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029564 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029564 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014604 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014604 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014604 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014604 Rosetta Predictions human pricing
NM_001025419 Rosetta Predictions rat pricing
NM_029564 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203645 predicted 311
2 SASI_Hs01_00203646 predicted 636
3 SASI_Hs01_00203647 predicted 304
4 SASI_Hs01_00203648 predicted 367
5 SASI_Hs01_00203649 predicted 761
6 SASI_Hs01_00203650 predicted 1010
7 SASI_Hs01_00203651 predicted 288
8 SASI_Hs01_00203653 predicted 469
9 SASI_Hs01_00203654 predicted 241
10 SASI_Hs02_00345889 predicted 307
11 SASI_Hs01_00203652 predicted 1020
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025419 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069357 predicted 224
2 SASI_Rn01_00069359 predicted 641
3 SASI_Rn01_00069360 predicted 245
4 SASI_Rn01_00069361 predicted 651
5 SASI_Rn01_00069362 predicted 526
6 SASI_Rn02_00203156 predicted 429
7 SASI_Rn01_00069364 predicted 555
8 SASI_Rn01_00069365 predicted 551
9 SASI_Rn01_00069366 predicted 513
10 SASI_Rn02_00203157 predicted 520
11 SASI_Rn01_00069358 predicted 440
12 SASI_Rn01_00069363 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125389 predicted 338
2 SASI_Mm01_00125391 predicted 925
3 SASI_Mm01_00125392 predicted 704
4 SASI_Mm01_00125393 predicted 365
5 SASI_Mm01_00125394 predicted 432
6 SASI_Mm01_00125395 predicted 696
7 SASI_Mm02_00335512 predicted 438
8 SASI_Mm01_00125396 predicted 263
9 SASI_Mm01_00125398 predicted 818
10 SASI_Mm02_00335513 predicted 806
11 SASI_Mm01_00125390 predicted 263
12 SASI_Mm01_00125397 predicted 642
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029564
TAX1BP3 MISSION shRNA Bacterial Glycerol Stock
Tax1 (human T-cell leukemia virus type I) binding protein 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029564.1-740s1c1
Sequence:CCGGGCCAACCTTCTTATCCCTCAACTCGAGTTGAGGGATAAGAAGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029564.1-271s1c1
Sequence:CCGGGAAATTCATAAGTTGCGTCAACTCGAGTTGACGCAACTTATGAATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029564.1-349s1c1
Sequence:CCGGCAGAATCCCTTCTCGGAAGATCTCGAGATCTTCCGAGAAGGGATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029564.1-445s1c1
Sequence:CCGGGACAAGATCATGCAGGTGAATCTCGAGATTCACCTGCATGATCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029564.1-255s1c1
Sequence:CCGGCGTAGTGCAAAGAGTTGAAATCTCGAGATTTCAACTCTTTGCACTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029564.2-835s21c1
Sequence:CCGGTCCAGTCTTCAGTAACCATAGCTCGAGCTATGGTTACTGAAGACTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029564.2-405s21c1
Sequence:CCGGGAGGGAGGTCCTGCTGAAATTCTCGAGAATTTCAGCAGGACCTCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029564.2-800s21c1
Sequence:CCGGGATACTGAGGATTGGGAATAACTCGAGTTATTCCCAATCCTCAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029564
TAX1BP3 MISSION shRNA shRNA Plasmid DNA
Tax1 (human T-cell leukemia virus type I) binding protein 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029564.1-740s1c1
Sequence:CCGGGCCAACCTTCTTATCCCTCAACTCGAGTTGAGGGATAAGAAGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029564.1-271s1c1
Sequence:CCGGGAAATTCATAAGTTGCGTCAACTCGAGTTGACGCAACTTATGAATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029564.1-349s1c1
Sequence:CCGGCAGAATCCCTTCTCGGAAGATCTCGAGATCTTCCGAGAAGGGATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029564.1-445s1c1
Sequence:CCGGGACAAGATCATGCAGGTGAATCTCGAGATTCACCTGCATGATCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029564.1-255s1c1
Sequence:CCGGCGTAGTGCAAAGAGTTGAAATCTCGAGATTTCAACTCTTTGCACTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029564.2-835s21c1
Sequence:CCGGTCCAGTCTTCAGTAACCATAGCTCGAGCTATGGTTACTGAAGACTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029564.2-405s21c1
Sequence:CCGGGAGGGAGGTCCTGCTGAAATTCTCGAGAATTTCAGCAGGACCTCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029564.2-800s21c1
Sequence:CCGGGATACTGAGGATTGGGAATAACTCGAGTTATTCCCAATCCTCAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029564
TAX1BP3 MISSION shRNA Lentiviral Transduction Particles
Tax1 (human T-cell leukemia virus type I) binding protein 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029564.1-740s1c1
Sequence:CCGGGCCAACCTTCTTATCCCTCAACTCGAGTTGAGGGATAAGAAGGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029564.1-271s1c1
Sequence:CCGGGAAATTCATAAGTTGCGTCAACTCGAGTTGACGCAACTTATGAATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029564.1-349s1c1
Sequence:CCGGCAGAATCCCTTCTCGGAAGATCTCGAGATCTTCCGAGAAGGGATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029564.1-445s1c1
Sequence:CCGGGACAAGATCATGCAGGTGAATCTCGAGATTCACCTGCATGATCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029564.1-255s1c1
Sequence:CCGGCGTAGTGCAAAGAGTTGAAATCTCGAGATTTCAACTCTTTGCACTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029564.2-835s21c1
Sequence:CCGGTCCAGTCTTCAGTAACCATAGCTCGAGCTATGGTTACTGAAGACTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029564.2-405s21c1
Sequence:CCGGGAGGGAGGTCCTGCTGAAATTCTCGAGAATTTCAGCAGGACCTCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029564.2-800s21c1
Sequence:CCGGGATACTGAGGATTGGGAATAACTCGAGTTATTCCCAATCCTCAGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014604
VALIDATED
TAX1BP3 MISSION shRNA Bacterial Glycerol Stock
Tax1 (human T-cell leukemia virus type I) binding protein 3
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014604.1-294s1c1
Sequence:CCGGCTCTGAAGACAAGACGGACAACTCGAGTTGTCCGTCTTGTCTTCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-379s1c1
Sequence:CCGGGACAAGATCATGCAGGTGAACCTCGAGGTTCACCTGCATGATCTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-303s1c1
Sequence:CCGGCAAGACGGACAAGGGTATTTACTCGAGTAAATACCCTTGTCCGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-227s1c1
Sequence:CCGGGTGAGAACTTAATCCTGGGTTCTCGAGAACCCAGGATTAAGTTCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014604.1-285s1c1
Sequence:CCGGGAATCCCTTCTCTGAAGACAACTCGAGTTGTCTTCAGAGAAGGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-366s1c1
Sequence:CCGGGCTGCAGATTGGAGACAAGATCTCGAGATCTTGTCTCCAATCTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014604.1-245s1c1
Sequence:CCGGGTTTCAGCATTGGAGGTGGAACTCGAGTTCCACCTCCAATGCTGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014604.1-369s1c1
Sequence:CCGGGCAGATTGGAGACAAGATCATCTCGAGATGATCTTGTCTCCAATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-310s1c1
Sequence:CCGGGACAAGGGTATTTATGTCACACTCGAGTGTGACATAAATACCCTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-195s1c1
Sequence:CCGGGCAAAGAGTTGAAATTCACAACTCGAGTTGTGAATTTCAACTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-189s1c1
Sequence:CCGGCGTGGTGCAAAGAGTTGAAATCTCGAGATTTCAACTCTTTGCACCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-202s1c1
Sequence:CCGGGTTGAAATTCACAAGCTGCGTCTCGAGACGCAGCTTGTGAATTTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014604.2-282s21c1
Sequence:CCGGGAATCCCTTCTCTGAAGACAACTCGAGTTGTCTTCAGAGAAGGGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014604.2-199s21c1
Sequence:CCGGGTTGAAATTCACAAGCTGCGTCTCGAGACGCAGCTTGTGAATTTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014604.2-376s21c1
Sequence:CCGGGACAAGATCATGCAGGTGAACCTCGAGGTTCACCTGCATGATCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014604.2-300s21c1
Sequence:CCGGCAAGACGGACAAGGGTATTTACTCGAGTAAATACCCTTGTCCGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014604.2-363s21c1
Sequence:CCGGGCTGCAGATTGGAGACAAGATCTCGAGATCTTGTCTCCAATCTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014604
VALIDATED
TAX1BP3 MISSION shRNA shRNA Plasmid DNA
Tax1 (human T-cell leukemia virus type I) binding protein 3
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014604.1-294s1c1
Sequence:CCGGCTCTGAAGACAAGACGGACAACTCGAGTTGTCCGTCTTGTCTTCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-379s1c1
Sequence:CCGGGACAAGATCATGCAGGTGAACCTCGAGGTTCACCTGCATGATCTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-303s1c1
Sequence:CCGGCAAGACGGACAAGGGTATTTACTCGAGTAAATACCCTTGTCCGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-227s1c1
Sequence:CCGGGTGAGAACTTAATCCTGGGTTCTCGAGAACCCAGGATTAAGTTCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014604.1-285s1c1
Sequence:CCGGGAATCCCTTCTCTGAAGACAACTCGAGTTGTCTTCAGAGAAGGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-366s1c1
Sequence:CCGGGCTGCAGATTGGAGACAAGATCTCGAGATCTTGTCTCCAATCTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014604.1-245s1c1
Sequence:CCGGGTTTCAGCATTGGAGGTGGAACTCGAGTTCCACCTCCAATGCTGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014604.1-369s1c1
Sequence:CCGGGCAGATTGGAGACAAGATCATCTCGAGATGATCTTGTCTCCAATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-310s1c1
Sequence:CCGGGACAAGGGTATTTATGTCACACTCGAGTGTGACATAAATACCCTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-195s1c1
Sequence:CCGGGCAAAGAGTTGAAATTCACAACTCGAGTTGTGAATTTCAACTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-189s1c1
Sequence:CCGGCGTGGTGCAAAGAGTTGAAATCTCGAGATTTCAACTCTTTGCACCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-202s1c1
Sequence:CCGGGTTGAAATTCACAAGCTGCGTCTCGAGACGCAGCTTGTGAATTTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014604.2-282s21c1
Sequence:CCGGGAATCCCTTCTCTGAAGACAACTCGAGTTGTCTTCAGAGAAGGGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014604.2-199s21c1
Sequence:CCGGGTTGAAATTCACAAGCTGCGTCTCGAGACGCAGCTTGTGAATTTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014604.2-376s21c1
Sequence:CCGGGACAAGATCATGCAGGTGAACCTCGAGGTTCACCTGCATGATCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014604.2-300s21c1
Sequence:CCGGCAAGACGGACAAGGGTATTTACTCGAGTAAATACCCTTGTCCGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014604.2-363s21c1
Sequence:CCGGGCTGCAGATTGGAGACAAGATCTCGAGATCTTGTCTCCAATCTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014604
VALIDATED
TAX1BP3 MISSION shRNA Lentiviral Transduction Particles
Tax1 (human T-cell leukemia virus type I) binding protein 3
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014604.1-294s1c1
Sequence:CCGGCTCTGAAGACAAGACGGACAACTCGAGTTGTCCGTCTTGTCTTCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-379s1c1
Sequence:CCGGGACAAGATCATGCAGGTGAACCTCGAGGTTCACCTGCATGATCTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-303s1c1
Sequence:CCGGCAAGACGGACAAGGGTATTTACTCGAGTAAATACCCTTGTCCGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-227s1c1
Sequence:CCGGGTGAGAACTTAATCCTGGGTTCTCGAGAACCCAGGATTAAGTTCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014604.1-285s1c1
Sequence:CCGGGAATCCCTTCTCTGAAGACAACTCGAGTTGTCTTCAGAGAAGGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-366s1c1
Sequence:CCGGGCTGCAGATTGGAGACAAGATCTCGAGATCTTGTCTCCAATCTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014604.1-245s1c1
Sequence:CCGGGTTTCAGCATTGGAGGTGGAACTCGAGTTCCACCTCCAATGCTGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014604.1-369s1c1
Sequence:CCGGGCAGATTGGAGACAAGATCATCTCGAGATGATCTTGTCTCCAATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-310s1c1
Sequence:CCGGGACAAGGGTATTTATGTCACACTCGAGTGTGACATAAATACCCTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-195s1c1
Sequence:CCGGGCAAAGAGTTGAAATTCACAACTCGAGTTGTGAATTTCAACTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-189s1c1
Sequence:CCGGCGTGGTGCAAAGAGTTGAAATCTCGAGATTTCAACTCTTTGCACCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014604.1-202s1c1
Sequence:CCGGGTTGAAATTCACAAGCTGCGTCTCGAGACGCAGCTTGTGAATTTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014604.2-282s21c1
Sequence:CCGGGAATCCCTTCTCTGAAGACAACTCGAGTTGTCTTCAGAGAAGGGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014604.2-199s21c1
Sequence:CCGGGTTGAAATTCACAAGCTGCGTCTCGAGACGCAGCTTGTGAATTTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014604.2-376s21c1
Sequence:CCGGGACAAGATCATGCAGGTGAACCTCGAGGTTCACCTGCATGATCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014604.2-300s21c1
Sequence:CCGGCAAGACGGACAAGGGTATTTACTCGAGTAAATACCCTTGTCCGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014604.2-363s21c1
Sequence:CCGGGCTGCAGATTGGAGACAAGATCTCGAGATCTTGTCTCCAATCTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)