EMAIL THIS PAGE TO A FRIEND

TBC1D3F

TBC1 domain family, member 3F

9 Gene Product Result for
Synonyms: TBC1D3
Species: Human TBC1D3F(84218)
UniProtKB ID: A6NER0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032258 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032258 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032258 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032258 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029618 predicted 987
2 SASI_Hs01_00029619 predicted 990
3 SASI_Hs02_00359565 predicted 501
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032258
TBC1D3F MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 3F
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032258.1-1904s1c1
Sequence:CCGGCCAGATCACAAAGCCAACCATCTCGAGATGGTTGGCTTTGTGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032258.1-993s1c1
Sequence:CCGGCCGATAACAAGAATCGCCTTTCTCGAGAAAGGCGATTCTTGTTATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032258.1-992s1c1
Sequence:CCGGGCCGATAACAAGAATCGCCTTCTCGAGAAGGCGATTCTTGTTATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032258.1-141s1c1
Sequence:CCGGCGAGAGGACATCATTATGAAACTCGAGTTTCATAATGATGTCCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032258.1-1712s1c1
Sequence:CCGGCCACTTGGAAAGTTCTCAGTTCTCGAGAACTGAGAACTTTCCAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032258.2-597s21c1
Sequence:CCGGGGGACGTAAGCGGGACATTAACTCGAGTTAATGTCCCGCTTACGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032258.2-1168s21c1
Sequence:CCGGCACTGTGCTCAAGCATCTTAGCTCGAGCTAAGATGCTTGAGCACAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032258.2-1835s21c1
Sequence:CCGGGATAATTTCCCTAGGCTTAACCTCGAGGTTAAGCCTAGGGAAATTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032258.2-960s21c1
Sequence:CCGGGCCTCATCCGGATATTGATTGCTCGAGCAATCAATATCCGGATGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032258
TBC1D3F MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 3F
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032258.1-1904s1c1
Sequence:CCGGCCAGATCACAAAGCCAACCATCTCGAGATGGTTGGCTTTGTGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032258.1-993s1c1
Sequence:CCGGCCGATAACAAGAATCGCCTTTCTCGAGAAAGGCGATTCTTGTTATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032258.1-992s1c1
Sequence:CCGGGCCGATAACAAGAATCGCCTTCTCGAGAAGGCGATTCTTGTTATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032258.1-141s1c1
Sequence:CCGGCGAGAGGACATCATTATGAAACTCGAGTTTCATAATGATGTCCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032258.1-1712s1c1
Sequence:CCGGCCACTTGGAAAGTTCTCAGTTCTCGAGAACTGAGAACTTTCCAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032258.2-597s21c1
Sequence:CCGGGGGACGTAAGCGGGACATTAACTCGAGTTAATGTCCCGCTTACGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032258.2-1168s21c1
Sequence:CCGGCACTGTGCTCAAGCATCTTAGCTCGAGCTAAGATGCTTGAGCACAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032258.2-1835s21c1
Sequence:CCGGGATAATTTCCCTAGGCTTAACCTCGAGGTTAAGCCTAGGGAAATTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032258.2-960s21c1
Sequence:CCGGGCCTCATCCGGATATTGATTGCTCGAGCAATCAATATCCGGATGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032258
TBC1D3F MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 3F
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032258.1-1904s1c1
Sequence:CCGGCCAGATCACAAAGCCAACCATCTCGAGATGGTTGGCTTTGTGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032258.1-993s1c1
Sequence:CCGGCCGATAACAAGAATCGCCTTTCTCGAGAAAGGCGATTCTTGTTATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032258.1-992s1c1
Sequence:CCGGGCCGATAACAAGAATCGCCTTCTCGAGAAGGCGATTCTTGTTATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032258.1-141s1c1
Sequence:CCGGCGAGAGGACATCATTATGAAACTCGAGTTTCATAATGATGTCCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032258.1-1712s1c1
Sequence:CCGGCCACTTGGAAAGTTCTCAGTTCTCGAGAACTGAGAACTTTCCAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032258.2-597s21c1
Sequence:CCGGGGGACGTAAGCGGGACATTAACTCGAGTTAATGTCCCGCTTACGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032258.2-1168s21c1
Sequence:CCGGCACTGTGCTCAAGCATCTTAGCTCGAGCTAAGATGCTTGAGCACAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032258.2-1835s21c1
Sequence:CCGGGATAATTTCCCTAGGCTTAACCTCGAGGTTAAGCCTAGGGAAATTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032258.2-960s21c1
Sequence:CCGGGCCTCATCCGGATATTGATTGCTCGAGCAATCAATATCCGGATGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)