EMAIL THIS PAGE TO A FRIEND

TBC1D3P2

TBC1 domain family, member 3 pseudogene 2

5 Gene Product Result for
Species: Human TBC1D3P2(440452)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_496235 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_496235 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_496235 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127991 MISSION® esiRNA esiRNA human TBC1D3P2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_496235
TBC1D3P2 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 3 pseudogene 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496235.1-1002s1c1
Sequence:CCGGCGGGACATTAAGGAGGCATATCTCGAGATATGCCTCCTTAATGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496235.1-1617s1c1
Sequence:CCGGCCGGATATTGATTGATGGGATCTCGAGATCCCATCAATCAATATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496235.1-1063s1c1
Sequence:CCGGCTTTACATCCTCCTGGCGTATCTCGAGATACGCCAGGAGGATGTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496235.1-157s1c1
Sequence:CCGGCAGAATCAGGTGGAAACCATTCTCGAGAATGGTTTCCACCTGATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496235.1-632s1c1
Sequence:CCGGGCTCAGCAGTTCTGTCGCAAACTCGAGTTTGCGACAGAACTGCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_496235
TBC1D3P2 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 3 pseudogene 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496235.1-1002s1c1
Sequence:CCGGCGGGACATTAAGGAGGCATATCTCGAGATATGCCTCCTTAATGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496235.1-1617s1c1
Sequence:CCGGCCGGATATTGATTGATGGGATCTCGAGATCCCATCAATCAATATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496235.1-1063s1c1
Sequence:CCGGCTTTACATCCTCCTGGCGTATCTCGAGATACGCCAGGAGGATGTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496235.1-157s1c1
Sequence:CCGGCAGAATCAGGTGGAAACCATTCTCGAGAATGGTTTCCACCTGATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496235.1-632s1c1
Sequence:CCGGGCTCAGCAGTTCTGTCGCAAACTCGAGTTTGCGACAGAACTGCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_496235
TBC1D3P2 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 3 pseudogene 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496235.1-1002s1c1
Sequence:CCGGCGGGACATTAAGGAGGCATATCTCGAGATATGCCTCCTTAATGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496235.1-1617s1c1
Sequence:CCGGCCGGATATTGATTGATGGGATCTCGAGATCCCATCAATCAATATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496235.1-1063s1c1
Sequence:CCGGCTTTACATCCTCCTGGCGTATCTCGAGATACGCCAGGAGGATGTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496235.1-157s1c1
Sequence:CCGGCAGAATCAGGTGGAAACCATTCTCGAGAATGGTTTCCACCTGATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496235.1-632s1c1
Sequence:CCGGGCTCAGCAGTTCTGTCGCAAACTCGAGTTTGCGACAGAACTGCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)