EMAIL THIS PAGE TO A FRIEND

TCEA1P3

transcription elongation factor A (SII), 1 pseudogene 3

Gene Product Result for
Species: Human TCEA1P3(340501)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_294568
TCEA1P3 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII), 1 pseudogene 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294568.2-400s1c1
Sequence:CCGGGCTGTCACCATTATTCAAGTTCTCGAGAACTTGAATAATGGTGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294568.2-490s1c1
Sequence:CCGGGCTAAGAAGATGGACGAGATACTCGAGTATCTCGTCCATCTTCTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294568.2-648s1c1
Sequence:CCGGTCTAGCAAAGTCTTTCGTCAACTCGAGTTGACGAAAGACTTTGCTAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294568.2-1021s1c1
Sequence:CCGGGCTAGAATGTCCGCAGAAGAACTCGAGTTCTTCTGCGGACATTCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294568.2-211s1c1
Sequence:CCGGCAAGCCTTTGAGCTTCTGATTCTCGAGAATCAGAAGCTCAAAGGCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_294568
TCEA1P3 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII), 1 pseudogene 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294568.2-400s1c1
Sequence:CCGGGCTGTCACCATTATTCAAGTTCTCGAGAACTTGAATAATGGTGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294568.2-490s1c1
Sequence:CCGGGCTAAGAAGATGGACGAGATACTCGAGTATCTCGTCCATCTTCTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294568.2-648s1c1
Sequence:CCGGTCTAGCAAAGTCTTTCGTCAACTCGAGTTGACGAAAGACTTTGCTAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294568.2-1021s1c1
Sequence:CCGGGCTAGAATGTCCGCAGAAGAACTCGAGTTCTTCTGCGGACATTCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294568.2-211s1c1
Sequence:CCGGCAAGCCTTTGAGCTTCTGATTCTCGAGAATCAGAAGCTCAAAGGCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_294568
TCEA1P3 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII), 1 pseudogene 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294568.2-400s1c1
Sequence:CCGGGCTGTCACCATTATTCAAGTTCTCGAGAACTTGAATAATGGTGACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294568.2-490s1c1
Sequence:CCGGGCTAAGAAGATGGACGAGATACTCGAGTATCTCGTCCATCTTCTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294568.2-648s1c1
Sequence:CCGGTCTAGCAAAGTCTTTCGTCAACTCGAGTTGACGAAAGACTTTGCTAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294568.2-1021s1c1
Sequence:CCGGGCTAGAATGTCCGCAGAAGAACTCGAGTTCTTCTGCGGACATTCTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294568.2-211s1c1
Sequence:CCGGCAAGCCTTTGAGCTTCTGATTCTCGAGAATCAGAAGCTCAAAGGCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)