EMAIL THIS PAGE TO A FRIEND

TCEAL5

transcription elongation factor A (SII)-like 5

52 Gene Product Result for
UniProtKB ID: Q5H9L2, A2RUJ4
Gene ID:
Human(340543) Summary: This gene, which is located on the X chromosome, encodes a protein which contains a BEX (brain expressed X-liked like family) domain. This domain is found in proteins encoded by the TCEAL elongation factor (transcription elongation factor A (SII)-like) gene family also located on the X chromosome. The coding region for this gene is located entirely in the terminal exon. [provided by RefSeq, Sep 2011]
Mouse(331532) transcription elongation factor A (SII)-like 5
Rat(680282) transcription elongation factor A (SII)-like 5
domestic cat(101094829) transcription elongation factor A (SII)-like 5
dog(100688866) transcription elongation factor A (SII)-like 5
domestic guinea pig(100715606) transcription elongation factor A (SII)-like 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177919 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177919 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177919 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001012979 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012979 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012979 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012979 Rosetta Predictions human pricing
XM_001056444 Rosetta Predictions rat pricing
NM_177919 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146546 predicted 891
2 SASI_Hs01_00146549 predicted 888
3 SASI_Hs01_00146550 predicted 886
4 SASI_Hs02_00306278 predicted 876
5 SASI_Hs01_00146551 predicted 893
6 SASI_Hs02_00306279 predicted 913
7 SASI_Hs01_00146552 predicted 881
8 SASI_Hs01_00146553 predicted 915
9 SASI_Hs01_00146555 predicted 899
10 SASI_Hs02_00306280 predicted 874
11 SASI_Hs01_00146547 predicted 910
12 SASI_Hs01_00146548 predicted 914
13 SASI_Hs01_00146554 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056444 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283316 predicted 50
2 SASI_Rn02_00283317 predicted 169
3 SASI_Rn02_00283318 predicted 60
4 SASI_Rn02_00283319 predicted 63
5 SASI_Rn02_00283320 predicted 101
6 SASI_Rn02_00283321 predicted 175
7 SASI_Rn02_00283322 predicted 67
8 SASI_Rn02_00283323 predicted 53
9 SASI_Rn02_00283324 predicted 93
10 SASI_Rn02_00283325 predicted 101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177919 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069286 predicted 751
2 SASI_Mm01_00069287 predicted 267
3 SASI_Mm01_00069288 predicted 555
4 SASI_Mm01_00069289 predicted 677
5 SASI_Mm01_00069290 predicted 754
6 SASI_Mm01_00069291 predicted 564
7 SASI_Mm01_00069292 predicted 565
8 SASI_Mm01_00069293 predicted 671
9 SASI_Mm01_00069294 predicted 421
10 SASI_Mm01_00069295 predicted 540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177919
VALIDATED
TCEAL5 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII)-like 5
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177919.1-748s21c1
Sequence:CCGGGGGCCAGAAGGACTTAGAAGACTCGAGTCTTCTAAGTCCTTCTGGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177919.1-792s21c1
Sequence:CCGGAGCCTTTCCTTCTGGATTCTCCTCGAGGAGAATCCAGAAGGAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177919.1-236s21c1
Sequence:CCGGGAAGACGAAGGAAGTACAGAACTCGAGTTCTGTACTTCCTTCGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177919.1-246s21c1
Sequence:CCGGGAAGTACAGAAGAGGGAGGAACTCGAGTTCCTCCCTCTTCTGTACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177919.1-805s21c1
Sequence:CCGGGGATTCTCTGATGGGAAATATCTCGAGATATTTCCCATCAGAGAATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177919.1-778s21c1
Sequence:CCGGTGTTTAATGCCTTCAGCCTTTCTCGAGAAAGGCTGAAGGCATTAAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177919.1-779s1c1
Sequence:CCGGGTTTAATGCCTTCAGCCTTTCCTCGAGGAAAGGCTGAAGGCATTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177919.1-242s1c1
Sequence:CCGGGAAGGAAGTACAGAAGAGGGACTCGAGTCCCTCTTCTGTACTTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177919.1-246s1c1
Sequence:CCGGGAAGTACAGAAGAGGGAGGAACTCGAGTTCCTCCCTCTTCTGTACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177919.1-233s1c1
Sequence:CCGGGCAGAAGACGAAGGAAGTACACTCGAGTGTACTTCCTTCGTCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177919.1-760s1c1
Sequence:CCGGCTTAGAAGATGCTCCATTTGTCTCGAGACAAATGGAGCATCTTCTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177919.1-236s1c1
Sequence:CCGGGAAGACGAAGGAAGTACAGAACTCGAGTTCTGTACTTCCTTCGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200358    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177919.1-868s1c1
Sequence:CCGGGCTTTAACCTTGTGCCGAGATCTCGAGATCTCGGCACAAGGTTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177919.1-269s1c1
Sequence:CCGGGCAGATGAAGACAAGTCAGATCTCGAGATCTGACTTGTCTTCATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177919.1-758s1c1
Sequence:CCGGGACTTAGAAGATGCTCCATTTCTCGAGAAATGGAGCATCTTCTAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177919
VALIDATED
TCEAL5 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII)-like 5
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177919.1-748s21c1
Sequence:CCGGGGGCCAGAAGGACTTAGAAGACTCGAGTCTTCTAAGTCCTTCTGGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177919.1-792s21c1
Sequence:CCGGAGCCTTTCCTTCTGGATTCTCCTCGAGGAGAATCCAGAAGGAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177919.1-236s21c1
Sequence:CCGGGAAGACGAAGGAAGTACAGAACTCGAGTTCTGTACTTCCTTCGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177919.1-246s21c1
Sequence:CCGGGAAGTACAGAAGAGGGAGGAACTCGAGTTCCTCCCTCTTCTGTACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177919.1-805s21c1
Sequence:CCGGGGATTCTCTGATGGGAAATATCTCGAGATATTTCCCATCAGAGAATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177919.1-778s21c1
Sequence:CCGGTGTTTAATGCCTTCAGCCTTTCTCGAGAAAGGCTGAAGGCATTAAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177919.1-779s1c1
Sequence:CCGGGTTTAATGCCTTCAGCCTTTCCTCGAGGAAAGGCTGAAGGCATTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177919.1-242s1c1
Sequence:CCGGGAAGGAAGTACAGAAGAGGGACTCGAGTCCCTCTTCTGTACTTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177919.1-246s1c1
Sequence:CCGGGAAGTACAGAAGAGGGAGGAACTCGAGTTCCTCCCTCTTCTGTACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177919.1-233s1c1
Sequence:CCGGGCAGAAGACGAAGGAAGTACACTCGAGTGTACTTCCTTCGTCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177919.1-760s1c1
Sequence:CCGGCTTAGAAGATGCTCCATTTGTCTCGAGACAAATGGAGCATCTTCTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177919.1-236s1c1
Sequence:CCGGGAAGACGAAGGAAGTACAGAACTCGAGTTCTGTACTTCCTTCGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200358    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177919.1-868s1c1
Sequence:CCGGGCTTTAACCTTGTGCCGAGATCTCGAGATCTCGGCACAAGGTTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177919.1-269s1c1
Sequence:CCGGGCAGATGAAGACAAGTCAGATCTCGAGATCTGACTTGTCTTCATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177919.1-758s1c1
Sequence:CCGGGACTTAGAAGATGCTCCATTTCTCGAGAAATGGAGCATCTTCTAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177919
VALIDATED
TCEAL5 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII)-like 5
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177919.1-748s21c1
Sequence:CCGGGGGCCAGAAGGACTTAGAAGACTCGAGTCTTCTAAGTCCTTCTGGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177919.1-792s21c1
Sequence:CCGGAGCCTTTCCTTCTGGATTCTCCTCGAGGAGAATCCAGAAGGAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177919.1-236s21c1
Sequence:CCGGGAAGACGAAGGAAGTACAGAACTCGAGTTCTGTACTTCCTTCGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177919.1-246s21c1
Sequence:CCGGGAAGTACAGAAGAGGGAGGAACTCGAGTTCCTCCCTCTTCTGTACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177919.1-805s21c1
Sequence:CCGGGGATTCTCTGATGGGAAATATCTCGAGATATTTCCCATCAGAGAATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177919.1-778s21c1
Sequence:CCGGTGTTTAATGCCTTCAGCCTTTCTCGAGAAAGGCTGAAGGCATTAAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177919.1-779s1c1
Sequence:CCGGGTTTAATGCCTTCAGCCTTTCCTCGAGGAAAGGCTGAAGGCATTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177919.1-242s1c1
Sequence:CCGGGAAGGAAGTACAGAAGAGGGACTCGAGTCCCTCTTCTGTACTTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177919.1-246s1c1
Sequence:CCGGGAAGTACAGAAGAGGGAGGAACTCGAGTTCCTCCCTCTTCTGTACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177919.1-233s1c1
Sequence:CCGGGCAGAAGACGAAGGAAGTACACTCGAGTGTACTTCCTTCGTCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177919.1-760s1c1
Sequence:CCGGCTTAGAAGATGCTCCATTTGTCTCGAGACAAATGGAGCATCTTCTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177919.1-236s1c1
Sequence:CCGGGAAGACGAAGGAAGTACAGAACTCGAGTTCTGTACTTCCTTCGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200358    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177919.1-868s1c1
Sequence:CCGGGCTTTAACCTTGTGCCGAGATCTCGAGATCTCGGCACAAGGTTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177919.1-269s1c1
Sequence:CCGGGCAGATGAAGACAAGTCAGATCTCGAGATCTGACTTGTCTTCATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177919.1-758s1c1
Sequence:CCGGGACTTAGAAGATGCTCCATTTCTCGAGAAATGGAGCATCTTCTAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012979
TCEAL5 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII)-like 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012979.1-378s1c1
Sequence:CCGGGAAGTACAGAAGATGAAGGAACTCGAGTTCCTTCATCTTCTGTACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145301    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012979.1-1006s1c1
Sequence:CCGGCCTTAAGCTGATACTTTCCTTCTCGAGAAGGAAAGTATCAGCTTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012979.1-735s1c1
Sequence:CCGGGAGAATGTGGAGATGTGTCAACTCGAGTTGACACATCTCCACATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012979.1-479s1c1
Sequence:CCGGGATGAGGGACAACTGGAAGATCTCGAGATCTTCCAGTTGTCCCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012979.1-396s1c1
Sequence:CCGGGAAAGTCAGACGAGGAAGAAACTCGAGTTTCTTCCTCGTCTGACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012979.1-433s1c1
Sequence:CCGGGAAGACAGAATGCGAGGGAAACTCGAGTTTCCCTCGCATTCTGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012979.1-486s1c1
Sequence:CCGGGACAACTGGAAGATGAGGGAACTCGAGTTCCCTCATCTTCCAGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012979.1-991s1c1
Sequence:CCGGGCCTATGTGCTTTAACCTTAACTCGAGTTAAGGTTAAAGCACATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012979.1-920s1c1
Sequence:CCGGCTTTGGCCTTTAATTCTGATTCTCGAGAATCAGAATTAAAGGCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012979.1-890s1c1
Sequence:CCGGGACTTAGAAGATGTCCCATATCTCGAGATATGGGACATCTTCTAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012979
TCEAL5 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII)-like 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012979.1-378s1c1
Sequence:CCGGGAAGTACAGAAGATGAAGGAACTCGAGTTCCTTCATCTTCTGTACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145301    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012979.1-1006s1c1
Sequence:CCGGCCTTAAGCTGATACTTTCCTTCTCGAGAAGGAAAGTATCAGCTTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012979.1-735s1c1
Sequence:CCGGGAGAATGTGGAGATGTGTCAACTCGAGTTGACACATCTCCACATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012979.1-479s1c1
Sequence:CCGGGATGAGGGACAACTGGAAGATCTCGAGATCTTCCAGTTGTCCCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012979.1-396s1c1
Sequence:CCGGGAAAGTCAGACGAGGAAGAAACTCGAGTTTCTTCCTCGTCTGACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012979.1-433s1c1
Sequence:CCGGGAAGACAGAATGCGAGGGAAACTCGAGTTTCCCTCGCATTCTGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012979.1-486s1c1
Sequence:CCGGGACAACTGGAAGATGAGGGAACTCGAGTTCCCTCATCTTCCAGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012979.1-991s1c1
Sequence:CCGGGCCTATGTGCTTTAACCTTAACTCGAGTTAAGGTTAAAGCACATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012979.1-920s1c1
Sequence:CCGGCTTTGGCCTTTAATTCTGATTCTCGAGAATCAGAATTAAAGGCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012979.1-890s1c1
Sequence:CCGGGACTTAGAAGATGTCCCATATCTCGAGATATGGGACATCTTCTAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012979
TCEAL5 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII)-like 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012979.1-378s1c1
Sequence:CCGGGAAGTACAGAAGATGAAGGAACTCGAGTTCCTTCATCTTCTGTACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145301    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012979.1-1006s1c1
Sequence:CCGGCCTTAAGCTGATACTTTCCTTCTCGAGAAGGAAAGTATCAGCTTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012979.1-735s1c1
Sequence:CCGGGAGAATGTGGAGATGTGTCAACTCGAGTTGACACATCTCCACATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012979.1-479s1c1
Sequence:CCGGGATGAGGGACAACTGGAAGATCTCGAGATCTTCCAGTTGTCCCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012979.1-396s1c1
Sequence:CCGGGAAAGTCAGACGAGGAAGAAACTCGAGTTTCTTCCTCGTCTGACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012979.1-433s1c1
Sequence:CCGGGAAGACAGAATGCGAGGGAAACTCGAGTTTCCCTCGCATTCTGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012979.1-486s1c1
Sequence:CCGGGACAACTGGAAGATGAGGGAACTCGAGTTCCCTCATCTTCCAGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012979.1-991s1c1
Sequence:CCGGGCCTATGTGCTTTAACCTTAACTCGAGTTAAGGTTAAAGCACATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012979.1-920s1c1
Sequence:CCGGCTTTGGCCTTTAATTCTGATTCTCGAGAATCAGAATTAAAGGCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012979.1-890s1c1
Sequence:CCGGGACTTAGAAGATGTCCCATATCTCGAGATATGGGACATCTTCTAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)