EMAIL THIS PAGE TO A FRIEND

TEKT2

tektin 2 (testicular)

60 Gene Product Result for
Synonyms: TEKTB1 TEKTIN-T h-tektin-t
UniProtKB ID: Q9UIF3, A6NIS6, O60638
Gene ID:
Human(27285) Summary: This gene product belongs to the tektin family of proteins. Tektins comprise a family of filament-forming proteins that are coassembled with tubulins to form ciliary and flagellar microtubules. This gene is expressed in the testis and its protein is localized to the flagella of the sperms, indicating that it may play a role in spermatogenesis. [provided by RefSeq, Jul 2008]
Mouse(24084) tektin 2
Rat(298532) tektin 2 (testicular)
Zebrafish(550629) tektin 2 (testicular)
domestic cat(101087503) tektin 2 (testicular)
dog(482479) tektin 2 (testicular)
chicken(419627) tektin 2 (testicular)
domestic guinea pig(100722172) tektin 2 (testicular)
Domestic Rabbit(100346828) tektin 2 (testicular)
naked mole-rat(101717196) tektin 2 (testicular)
cow(514463) tektin 2 (testicular)
sheep(101111755) tektin 2 (testicular)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014466 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014466 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014466 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011902 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011902 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011902 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080861 MISSION® esiRNA esiRNA human TEKT2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014466 Rosetta Predictions human pricing
NM_001011977 Rosetta Predictions rat pricing
XM_575908 Rosetta Predictions rat pricing
NM_011902 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045340 predicted 282
2 SASI_Hs01_00045341 predicted 894
3 SASI_Hs01_00045342 predicted 953
4 SASI_Hs01_00045343 predicted 1127
5 SASI_Hs01_00045344 predicted 483
6 SASI_Hs02_00345687 predicted 955
7 SASI_Hs01_00045345 predicted 551
8 SASI_Hs01_00045346 predicted 1065
9 SASI_Hs01_00045347 predicted 1082
10 SASI_Hs01_00045348 predicted 475
11 SASI_Hs01_00045339 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011977 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043634 predicted 878
2 SASI_Rn01_00043636 predicted 848
3 SASI_Rn01_00043637 predicted 839
4 SASI_Rn01_00043639 predicted 1064
5 SASI_Rn01_00043640 predicted 865
6 SASI_Rn01_00043641 predicted 1153
7 SASI_Rn02_00199999 predicted 431
8 SASI_Rn02_00200000 predicted 522
9 SASI_Rn01_00043642 predicted 1186
10 SASI_Rn01_00043643 predicted 1208
11 SASI_Rn01_00043635 predicted 809
12 SASI_Rn01_00043638 predicted 1281
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575908 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00124521 predicted 384
2 SASI_Rn01_00124522 predicted 381
3 SASI_Rn01_00124523 predicted 305
4 SASI_Rn01_00124524 predicted 251
5 SASI_Rn01_00124525 predicted 375
6 SASI_Rn01_00124526 predicted 219
7 SASI_Rn01_00124527 predicted 247
8 SASI_Rn01_00124528 predicted 214
9 SASI_Rn01_00124529 predicted 357
10 SASI_Rn01_00124530 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011902 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039088 predicted 848
2 SASI_Mm02_00321713 predicted 773
3 SASI_Mm01_00039089 predicted 1108
4 SASI_Mm01_00039090 predicted 264
5 SASI_Mm01_00039091 predicted 1193
6 SASI_Mm01_00039092 predicted 263
7 SASI_Mm01_00039093 predicted 806
8 SASI_Mm01_00039094 predicted 1144
9 SASI_Mm01_00039095 predicted 521
10 SASI_Mm01_00039097 predicted 350
11 SASI_Mm01_00039096 predicted 1031
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014466
TEKT2 MISSION shRNA Bacterial Glycerol Stock
tektin 2 (testicular)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014466.2-220s21c1
Sequence:CCGGGCGAGATGCTTCCCATCAGATCTCGAGATCTGATGGGAAGCATCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014466.2-189s21c1
Sequence:CCGGGCTACCTGCTATCCACCAATGCTCGAGCATTGGTGGATAGCAGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014466.2-363s21c1
Sequence:CCGGACAAGTGTCTGACAGATTTAGCTCGAGCTAAATCTGTCAGACACTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014466.2-1356s1c1
Sequence:CCGGCCTTCACACGTACCACAAATACTCGAGTATTTGTGGTACGTGTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014466.2-716s1c1
Sequence:CCGGCCAAACATCTCGCTGAAGGTTCTCGAGAACCTTCAGCGAGATGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014466.2-895s1c1
Sequence:CCGGCCAGAGAGTTGCAACGGAATTCTCGAGAATTCCGTTGCAACTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014466.2-872s1c1
Sequence:CCGGGAGACCAACAACGAGCTTGAACTCGAGTTCAAGCTCGTTGTTGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014466.2-781s21c1
Sequence:CCGGGGATGACTTCAGTCGGTTCAACTCGAGTTGAACCGACTGAAGTCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014466.2-281s1c1
Sequence:CCGGCAGACCATTTGGGATGAACATCTCGAGATGTTCATCCCAAATGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014466
TEKT2 MISSION shRNA shRNA Plasmid DNA
tektin 2 (testicular)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014466.2-220s21c1
Sequence:CCGGGCGAGATGCTTCCCATCAGATCTCGAGATCTGATGGGAAGCATCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014466.2-189s21c1
Sequence:CCGGGCTACCTGCTATCCACCAATGCTCGAGCATTGGTGGATAGCAGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014466.2-363s21c1
Sequence:CCGGACAAGTGTCTGACAGATTTAGCTCGAGCTAAATCTGTCAGACACTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014466.2-1356s1c1
Sequence:CCGGCCTTCACACGTACCACAAATACTCGAGTATTTGTGGTACGTGTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014466.2-716s1c1
Sequence:CCGGCCAAACATCTCGCTGAAGGTTCTCGAGAACCTTCAGCGAGATGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014466.2-895s1c1
Sequence:CCGGCCAGAGAGTTGCAACGGAATTCTCGAGAATTCCGTTGCAACTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014466.2-872s1c1
Sequence:CCGGGAGACCAACAACGAGCTTGAACTCGAGTTCAAGCTCGTTGTTGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014466.2-781s21c1
Sequence:CCGGGGATGACTTCAGTCGGTTCAACTCGAGTTGAACCGACTGAAGTCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014466.2-281s1c1
Sequence:CCGGCAGACCATTTGGGATGAACATCTCGAGATGTTCATCCCAAATGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014466
TEKT2 MISSION shRNA Lentiviral Transduction Particles
tektin 2 (testicular)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014466.2-220s21c1
Sequence:CCGGGCGAGATGCTTCCCATCAGATCTCGAGATCTGATGGGAAGCATCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014466.2-189s21c1
Sequence:CCGGGCTACCTGCTATCCACCAATGCTCGAGCATTGGTGGATAGCAGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014466.2-363s21c1
Sequence:CCGGACAAGTGTCTGACAGATTTAGCTCGAGCTAAATCTGTCAGACACTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014466.2-1356s1c1
Sequence:CCGGCCTTCACACGTACCACAAATACTCGAGTATTTGTGGTACGTGTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014466.2-716s1c1
Sequence:CCGGCCAAACATCTCGCTGAAGGTTCTCGAGAACCTTCAGCGAGATGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014466.2-895s1c1
Sequence:CCGGCCAGAGAGTTGCAACGGAATTCTCGAGAATTCCGTTGCAACTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014466.2-872s1c1
Sequence:CCGGGAGACCAACAACGAGCTTGAACTCGAGTTCAAGCTCGTTGTTGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014466.2-781s21c1
Sequence:CCGGGGATGACTTCAGTCGGTTCAACTCGAGTTGAACCGACTGAAGTCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014466.2-281s1c1
Sequence:CCGGCAGACCATTTGGGATGAACATCTCGAGATGTTCATCCCAAATGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011902
TEKT2 MISSION shRNA Bacterial Glycerol Stock
tektin 2 (testicular)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011902.1-248s1c1
Sequence:CCGGCCTTCGCAATGAGACAAACAACTCGAGTTGTTTGTCTCATTGCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011902.1-807s1c1
Sequence:CCGGGCCGAAATGAAAGCGTCCATACTCGAGTATGGACGCTTTCATTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011902.1-1028s1c1
Sequence:CCGGGCGTAGAAAGATGATGAACTTCTCGAGAAGTTCATCATCTTTCTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011902.1-249s1c1
Sequence:CCGGCTTCGCAATGAGACAAACAATCTCGAGATTGTTTGTCTCATTGCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011902.1-1112s1c1
Sequence:CCGGCCAGACACAGTATGGCCTCATCTCGAGATGAGGCCATACTGTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011902
TEKT2 MISSION shRNA shRNA Plasmid DNA
tektin 2 (testicular)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011902.1-248s1c1
Sequence:CCGGCCTTCGCAATGAGACAAACAACTCGAGTTGTTTGTCTCATTGCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011902.1-807s1c1
Sequence:CCGGGCCGAAATGAAAGCGTCCATACTCGAGTATGGACGCTTTCATTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011902.1-1028s1c1
Sequence:CCGGGCGTAGAAAGATGATGAACTTCTCGAGAAGTTCATCATCTTTCTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011902.1-249s1c1
Sequence:CCGGCTTCGCAATGAGACAAACAATCTCGAGATTGTTTGTCTCATTGCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011902.1-1112s1c1
Sequence:CCGGCCAGACACAGTATGGCCTCATCTCGAGATGAGGCCATACTGTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011902
TEKT2 MISSION shRNA Lentiviral Transduction Particles
tektin 2 (testicular)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011902.1-248s1c1
Sequence:CCGGCCTTCGCAATGAGACAAACAACTCGAGTTGTTTGTCTCATTGCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011902.1-807s1c1
Sequence:CCGGGCCGAAATGAAAGCGTCCATACTCGAGTATGGACGCTTTCATTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011902.1-1028s1c1
Sequence:CCGGGCGTAGAAAGATGATGAACTTCTCGAGAAGTTCATCATCTTTCTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011902.1-249s1c1
Sequence:CCGGCTTCGCAATGAGACAAACAATCTCGAGATTGTTTGTCTCATTGCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011902.1-1112s1c1
Sequence:CCGGCCAGACACAGTATGGCCTCATCTCGAGATGAGGCCATACTGTGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)