EMAIL THIS PAGE TO A FRIEND

TMEM75

transmembrane protein 75

42 Gene Product Result for
Species: Human TMEM75(641384)
UniProtKB ID: Q8N9X5, B2RPD6, B9EH93
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV44839 Anti-TMEM75 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037234 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037234 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037234 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037234 Rosetta Predictions human pricing
XR_040740 Rosetta Predictions human pricing
XR_040741 Rosetta Predictions human pricing
XR_040742 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217003 predicted 1356
2 SASI_Hs01_00217004 predicted 1322
3 SASI_Hs01_00217005 predicted 1320
4 SASI_Hs01_00217006 predicted 950
5 SASI_Hs01_00217007 predicted 954
6 SASI_Hs01_00217008 predicted 1138
7 SASI_Hs01_00217009 predicted 1382
8 SASI_Hs01_00217010 predicted 928
9 SASI_Hs01_00217011 predicted 729
10 SASI_Hs01_00217012 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040740 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521501 predicted 536
2 SASI_Hs02_00521502 predicted 540
3 SASI_Hs02_00521503 predicted 536
4 SASI_Hs02_00521504 predicted 529
5 SASI_Hs02_00521505 predicted 552
6 SASI_Hs02_00521506 predicted 525
7 SASI_Hs02_00521507 predicted 529
8 SASI_Hs02_00521508 predicted 421
9 SASI_Hs02_00521509 predicted 451
10 SASI_Hs02_00521510 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521511 predicted 532
2 SASI_Hs02_00521512 predicted 534
3 SASI_Hs02_00521513 predicted 536
4 SASI_Hs02_00521514 predicted 533
5 SASI_Hs02_00521515 predicted 554
6 SASI_Hs02_00521516 predicted 528
7 SASI_Hs02_00521517 predicted 524
8 SASI_Hs02_00521518 predicted 428
9 SASI_Hs02_00521519 predicted 448
10 SASI_Hs02_00521520 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521521 predicted 530
2 SASI_Hs02_00521522 predicted 538
3 SASI_Hs02_00521523 predicted 536
4 SASI_Hs02_00521524 predicted 530
5 SASI_Hs02_00521525 predicted 547
6 SASI_Hs02_00521526 predicted 522
7 SASI_Hs02_00521527 predicted 528
8 SASI_Hs02_00521528 predicted 422
9 SASI_Hs02_00521529 predicted 449
10 SASI_Hs02_00521530 predicted 419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037234
TMEM75 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 75
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000178875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037234.1-986s1c1
Sequence:CCGGCTTCAGTCTTCCATTCACAGACTCGAGTCTGTGAATGGAAGACTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001037234.1-1412s1c1
Sequence:CCGGCCTGTCCAATTCTTTCCCAATCTCGAGATTGGGAAAGAATTGGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037234
TMEM75 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 75
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000178875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037234.1-986s1c1
Sequence:CCGGCTTCAGTCTTCCATTCACAGACTCGAGTCTGTGAATGGAAGACTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001037234.1-1412s1c1
Sequence:CCGGCCTGTCCAATTCTTTCCCAATCTCGAGATTGGGAAAGAATTGGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037234
TMEM75 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 75
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000178875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037234.1-986s1c1
Sequence:CCGGCTTCAGTCTTCCATTCACAGACTCGAGTCTGTGAATGGAAGACTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001037234.1-1412s1c1
Sequence:CCGGCCTGTCCAATTCTTTCCCAATCTCGAGATTGGGAAAGAATTGGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)