EMAIL THIS PAGE TO A FRIEND

TP53TG1

TP53 target 1 (non-protein coding)

14 Gene Product Result for
Synonyms: LINC00096 NCRNA00096 P53TG1 P53TG1-D TP53AP1
Species: Human TP53TG1(11257)
UniProtKB ID: Q9Y2A0, D6W5P2, Q52MB0, Q9Y2A1, Q9Y2A2, Q9Y2A3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407124 Anti-TP53AP1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007233 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007233 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007233 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147651 MISSION® esiRNA esiRNA human TP53TG1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_015381 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_015381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381384 predicted 381
2 SASI_Hs02_00381385 predicted 320
3 SASI_Hs02_00381386 predicted 216
4 SASI_Hs02_00381387 predicted 314
5 SASI_Hs02_00381388 predicted 282
6 SASI_Hs02_00381389 predicted 244
7 SASI_Hs02_00381390 predicted 308
8 SASI_Hs02_00381391 predicted 325
9 SASI_Hs02_00381392 predicted 215
10 SASI_Hs02_00381393 predicted 215
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007233
TP53TG1 MISSION shRNA Bacterial Glycerol Stock
TP53 target 1 (non-protein coding)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007233.1-341s1c1
Sequence:CCGGCGAACACTTACACCAGTGCTTCTCGAGAAGCACTGGTGTAAGTGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007233.1-232s1c1
Sequence:CCGGGATGCAGGAAGCGATGGTTAACTCGAGTTAACCATCGCTTCCTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007233.1-239s1c1
Sequence:CCGGGAAGCGATGGTTAAGACCCATCTCGAGATGGGTCTTAACCATCGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007233.1-683s1c1
Sequence:CCGGGAAAGCTAAATCTTCCCTCTTCTCGAGAAGAGGGAAGATTTAGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007233.1-697s1c1
Sequence:CCGGCCCTCTTAATGAATAAAGGTTCTCGAGAACCTTTATTCATTAAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007233.1-665s1c1
Sequence:CCGGCAGGAGACAAACTGTTTGGAACTCGAGTTCCAAACAGTTTGTCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007233.1-363s1c1
Sequence:CCGGGTAAAGGAATCTTATTGTCCACTCGAGTGGACAATAAGATTCCTTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007233
TP53TG1 MISSION shRNA shRNA Plasmid DNA
TP53 target 1 (non-protein coding)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007233.1-341s1c1
Sequence:CCGGCGAACACTTACACCAGTGCTTCTCGAGAAGCACTGGTGTAAGTGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007233.1-232s1c1
Sequence:CCGGGATGCAGGAAGCGATGGTTAACTCGAGTTAACCATCGCTTCCTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007233.1-239s1c1
Sequence:CCGGGAAGCGATGGTTAAGACCCATCTCGAGATGGGTCTTAACCATCGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007233.1-683s1c1
Sequence:CCGGGAAAGCTAAATCTTCCCTCTTCTCGAGAAGAGGGAAGATTTAGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007233.1-697s1c1
Sequence:CCGGCCCTCTTAATGAATAAAGGTTCTCGAGAACCTTTATTCATTAAGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007233.1-665s1c1
Sequence:CCGGCAGGAGACAAACTGTTTGGAACTCGAGTTCCAAACAGTTTGTCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007233.1-363s1c1
Sequence:CCGGGTAAAGGAATCTTATTGTCCACTCGAGTGGACAATAAGATTCCTTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007233
TP53TG1 MISSION shRNA Lentiviral Transduction Particles
TP53 target 1 (non-protein coding)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007233.1-341s1c1
Sequence:CCGGCGAACACTTACACCAGTGCTTCTCGAGAAGCACTGGTGTAAGTGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007233.1-232s1c1
Sequence:CCGGGATGCAGGAAGCGATGGTTAACTCGAGTTAACCATCGCTTCCTGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007233.1-239s1c1
Sequence:CCGGGAAGCGATGGTTAAGACCCATCTCGAGATGGGTCTTAACCATCGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007233.1-683s1c1
Sequence:CCGGGAAAGCTAAATCTTCCCTCTTCTCGAGAAGAGGGAAGATTTAGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007233.1-697s1c1
Sequence:CCGGCCCTCTTAATGAATAAAGGTTCTCGAGAACCTTTATTCATTAAGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007233.1-665s1c1
Sequence:CCGGCAGGAGACAAACTGTTTGGAACTCGAGTTCCAAACAGTTTGTCTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007233.1-363s1c1
Sequence:CCGGGTAAAGGAATCTTATTGTCCACTCGAGTGGACAATAAGATTCCTTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)