EMAIL THIS PAGE TO A FRIEND

TP53TG3B

TP53 target 3B

94 Gene Product Result for
Species: Human TP53TG3B(729355)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099687 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099687 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099687 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU115971 MISSION® esiRNA esiRNA human AC133485.1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099687 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321105 predicted 1683
2 SASI_Hs02_00321106 predicted 1826
3 SASI_Hs02_00321107 predicted 1625
4 SASI_Hs02_00321108 predicted 1689
5 SASI_Hs02_00321109 predicted 1675
6 SASI_Hs02_00321110 predicted 1546
7 SASI_Hs02_00321111 predicted 1619
8 SASI_Hs02_00321112 predicted 1546
9 SASI_Hs02_00321113 predicted 1670
10 SASI_Hs02_00321114 predicted 1607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099687
TP53TG3B MISSION shRNA Bacterial Glycerol Stock
TP53 target 3B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099687.1-1739s21c1
Sequence:CCGGGCTTGTCATGTTCGAAGTTTGCTCGAGCAAACTTCGAACATGACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099687.1-2657s21c1
Sequence:CCGGTTGCCCTCATGAGCGTGTTTACTCGAGTAAACACGCTCATGAGGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099687.1-1830s21c1
Sequence:CCGGGTTAAGTACTGCACGACTACTCTCGAGAGTAGTCGTGCAGTACTTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099687.1-1652s21c1
Sequence:CCGGTCTCCTGCTGAAGAGACATTGCTCGAGCAATGTCTCTTCAGCAGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099687.1-1683s21c1
Sequence:CCGGGGCTAGTTTCACCTGGTAATTCTCGAGAATTACCAGGTGAAACTAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099687
TP53TG3B MISSION shRNA shRNA Plasmid DNA
TP53 target 3B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099687.1-1739s21c1
Sequence:CCGGGCTTGTCATGTTCGAAGTTTGCTCGAGCAAACTTCGAACATGACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099687.1-2657s21c1
Sequence:CCGGTTGCCCTCATGAGCGTGTTTACTCGAGTAAACACGCTCATGAGGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099687.1-1830s21c1
Sequence:CCGGGTTAAGTACTGCACGACTACTCTCGAGAGTAGTCGTGCAGTACTTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099687.1-1652s21c1
Sequence:CCGGTCTCCTGCTGAAGAGACATTGCTCGAGCAATGTCTCTTCAGCAGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099687.1-1683s21c1
Sequence:CCGGGGCTAGTTTCACCTGGTAATTCTCGAGAATTACCAGGTGAAACTAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099687
TP53TG3B MISSION shRNA Lentiviral Transduction Particles
TP53 target 3B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099687.1-1739s21c1
Sequence:CCGGGCTTGTCATGTTCGAAGTTTGCTCGAGCAAACTTCGAACATGACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099687.1-2657s21c1
Sequence:CCGGTTGCCCTCATGAGCGTGTTTACTCGAGTAAACACGCTCATGAGGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099687.1-1830s21c1
Sequence:CCGGGTTAAGTACTGCACGACTACTCTCGAGAGTAGTCGTGCAGTACTTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099687.1-1652s21c1
Sequence:CCGGTCTCCTGCTGAAGAGACATTGCTCGAGCAATGTCTCTTCAGCAGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099687.1-1683s21c1
Sequence:CCGGGGCTAGTTTCACCTGGTAATTCTCGAGAATTACCAGGTGAAACTAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)