EMAIL THIS PAGE TO A FRIEND

TPO

thyroid peroxidase

133 Gene Product Result for
Synonyms: MSA TDH2A TPX
Gene ID:
Human(7173) Summary: This gene encodes a membrane-bound glycoprotein. The encoded protein acts as an enzyme and plays a central role in thyroid gland function. The protein functions in the iodination of tyrosine residues in thyroglobulin and phenoxy-ester formation between pairs of iodinated tyrosines to generate the thyroid hormones, thyroxine and triiodothyronine. Mutations in this gene are associated with several disorders of thyroid hormonogenesis, including congenital hypothyroidism, congenital goiter, and thyroid hormone organification defect IIA. Multiple transcript variants encoding distinct isoforms have been identified for this gene, but the full-length nature of some variants has not been determined. [provided by RefSeq, May 2011]
Mouse(22018) thyroid peroxidase
Rat(54314) thyroid peroxidase
cow(525013) thyroid peroxidase
naked mole-rat(101704548) thyroid peroxidase
domestic guinea pig(100723704) thyroid peroxidase
chicken(776120) thyroid peroxidase
domestic cat(101098706) thyroid peroxidase
dog(403521) thyroid peroxidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000547 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000547 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000547 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009417 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009417 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009417 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU073821 MISSION® esiRNA esiRNA human TPO (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000547 Rosetta Predictions human pricing
NM_175719 Rosetta Predictions human pricing
NM_175720 Rosetta Predictions human pricing
NM_175721 Rosetta Predictions human pricing
NM_175722 Rosetta Predictions human pricing
NM_019353 Rosetta Predictions rat pricing
NM_009417 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110879 predicted 439 149.00
2 SASI_Hs01_00110881 predicted 420 149.00
3 SASI_Hs01_00110882 predicted 536 149.00
4 SASI_Hs02_00302773 predicted 510 149.00
5 SASI_Hs02_00302774 predicted 507 149.00
6 SASI_Hs01_00110883 predicted 315 149.00
7 SASI_Hs01_00110884 predicted 615 149.00
8 SASI_Hs02_00302775 predicted 2111 149.00
9 SASI_Hs02_00302776 predicted 539 149.00
10 SASI_Hs02_00302777 predicted 2205 149.00
11 SASI_Hs01_00110880 predicted 2230 149.00
12 SASI_Hs01_00110885 predicted 295 149.00
13 SASI_Hs01_00110886 predicted 450 149.00
14 SASI_Hs01_00110887 predicted 2243 149.00
15 SASI_Hs01_00110888 predicted 510 149.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014453 predicted 444 149.00
2 SASI_Hs01_00014455 predicted 432 149.00
3 SASI_Hs01_00014456 predicted 538 149.00
4 SASI_Hs02_00369038 predicted 518 149.00
5 SASI_Hs02_00369039 predicted 516 149.00
6 SASI_Hs01_00014457 predicted 322 149.00
7 SASI_Hs01_00014458 predicted 620 149.00
8 SASI_Hs02_00369040 predicted 1946 149.00
9 SASI_Hs02_00369041 predicted 544 149.00
10 SASI_Hs02_00369042 predicted 2039 149.00
11 SASI_Hs01_00014454 predicted 2065 149.00
12 SASI_Hs01_00014459 predicted 296 149.00
13 SASI_Hs01_00014460 predicted 462 149.00
14 SASI_Hs01_00014461 predicted 2077 149.00
15 SASI_Hs01_00014462 predicted 516 149.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221228 predicted 445 149.00
2 SASI_Hs01_00221229 predicted 2231 149.00
3 SASI_Hs01_00221230 predicted 423 149.00
4 SASI_Hs01_00221231 predicted 546 149.00
5 SASI_Hs01_00221232 predicted 328 149.00
6 SASI_Hs01_00221233 predicted 616 149.00
7 SASI_Hs01_00221234 predicted 294 149.00
8 SASI_Hs01_00221235 predicted 455 149.00
9 SASI_Hs01_00221236 predicted 2247 149.00
10 SASI_Hs01_00221237 predicted 508 149.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183952 predicted 441 149.00
2 SASI_Hs01_00183954 predicted 420 149.00
3 SASI_Hs01_00183955 predicted 535 149.00
4 SASI_Hs02_00369043 predicted 512 149.00
5 SASI_Hs02_00369044 predicted 507 149.00
6 SASI_Hs01_00183956 predicted 321 149.00
7 SASI_Hs01_00183957 predicted 611 149.00
8 SASI_Hs02_00369045 predicted 2110 149.00
9 SASI_Hs02_00369046 predicted 532 149.00
10 SASI_Hs02_00369047 predicted 2200 149.00
11 SASI_Hs01_00183953 predicted 2231 149.00
12 SASI_Hs01_00183958 predicted 290 149.00
13 SASI_Hs01_00183959 predicted 455 149.00
14 SASI_Hs01_00183960 predicted 2241 149.00
15 SASI_Hs01_00183961 predicted 507 149.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048700 predicted 442 149.00
2 SASI_Hs01_00048702 predicted 421 149.00
3 SASI_Hs01_00048703 predicted 536 149.00
4 SASI_Hs02_00369048 predicted 510 149.00
5 SASI_Hs02_00369049 predicted 512 149.00
6 SASI_Hs01_00048704 predicted 316 149.00
7 SASI_Hs01_00048705 predicted 610 149.00
8 SASI_Hs02_00369050 predicted 1587 149.00
9 SASI_Hs02_00369051 predicted 532 149.00
10 SASI_Hs02_00369052 predicted 1686 149.00
11 SASI_Hs01_00048701 predicted 1709 149.00
12 SASI_Hs01_00048706 predicted 296 149.00
13 SASI_Hs01_00048707 predicted 450 149.00
14 SASI_Hs01_00048708 predicted 1729 149.00
15 SASI_Hs01_00048709 predicted 515 149.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019353 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108124 predicted 2807 149.00
2 SASI_Rn01_00108125 predicted 2822 149.00
3 SASI_Rn01_00108126 predicted 2843 149.00
4 SASI_Rn01_00108127 predicted 2290 149.00
5 SASI_Rn02_00262360 predicted 337 149.00
6 SASI_Rn01_00108128 predicted 337 149.00
7 SASI_Rn01_00108129 predicted 720 149.00
8 SASI_Rn01_00108130 predicted 2630 149.00
9 SASI_Rn01_00108133 predicted 559 149.00
10 SASI_Rn02_00262361 predicted 2486 149.00
11 SASI_Rn01_00108131 predicted 1074 149.00
12 SASI_Rn01_00108132 predicted 652 149.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009417 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038445 predicted 2549 149.00
2 SASI_Mm01_00038446 predicted 2288 149.00
3 SASI_Mm01_00038447 predicted 2533 149.00
4 SASI_Mm01_00038448 predicted 413 149.00
5 SASI_Mm01_00038449 predicted 2514 149.00
6 SASI_Mm01_00038450 predicted 696 149.00
7 SASI_Mm01_00038451 predicted 343 149.00
8 SASI_Mm01_00038452 predicted 755 149.00
9 SASI_Mm01_00038453 predicted 226 149.00
10 SASI_Mm01_00038454 predicted 371 149.00
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000547
TPO MISSION shRNA Bacterial Glycerol Stock
thyroid peroxidase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000547.5-1493s21c1
Sequence:CCGGGGTCCCTATGAAGGCTATGACCTCGAGGTCATAGCCTTCATAGGGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000547.5-2710s21c1
Sequence:CCGGGACACGCACTGGCACTAAATCCTCGAGGATTTAGTGCCAGTGCGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000547.5-2975s21c1
Sequence:CCGGGAAATCAGCAGGACGACTGTTCTCGAGAACAGTCGTCCTGCTGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000547.5-1430s21c1
Sequence:CCGGATCATCACCCTGAGGGATTACCTCGAGGTAATCCCTCAGGGTGATGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000547.5-1767s21c1
Sequence:CCGGAGCTGACGGAAAGGCTCTTTGCTCGAGCAAAGAGCCTTTCCGTCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000547.5-2958s21c1
Sequence:CCGGCAAACACAGGCAAATCCGAAACTCGAGTTTCGGATTTGCCTGTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000547.3-155s1c1
Sequence:CCGGCGAGAGGGAAAGAACTCCTTTCTCGAGAAAGGAGTTCTTTCCCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000547.3-453s1c1
Sequence:CCGGGCTGAGCATCATTGCAAACATCTCGAGATGTTTGCAATGATGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000547.3-2566s1c1
Sequence:CCGGCCCTACGAGTTAGGAGACGATCTCGAGATCGTCTCCTAACTCGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000547.3-742s1c1
Sequence:CCGGGTCACAGATGATGACCGCTATCTCGAGATAGCGGTCATCATCTGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000547.3-1941s1c1
Sequence:CCGGCGACAAGATCCTGGACTTGTACTCGAGTACAAGTCCAGGATCTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000547
TPO MISSION shRNA shRNA Plasmid DNA
thyroid peroxidase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000547.5-1493s21c1
Sequence:CCGGGGTCCCTATGAAGGCTATGACCTCGAGGTCATAGCCTTCATAGGGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000547.5-2710s21c1
Sequence:CCGGGACACGCACTGGCACTAAATCCTCGAGGATTTAGTGCCAGTGCGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000547.5-2975s21c1
Sequence:CCGGGAAATCAGCAGGACGACTGTTCTCGAGAACAGTCGTCCTGCTGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000547.5-1430s21c1
Sequence:CCGGATCATCACCCTGAGGGATTACCTCGAGGTAATCCCTCAGGGTGATGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000547.5-1767s21c1
Sequence:CCGGAGCTGACGGAAAGGCTCTTTGCTCGAGCAAAGAGCCTTTCCGTCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000547.5-2958s21c1
Sequence:CCGGCAAACACAGGCAAATCCGAAACTCGAGTTTCGGATTTGCCTGTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000547.3-155s1c1
Sequence:CCGGCGAGAGGGAAAGAACTCCTTTCTCGAGAAAGGAGTTCTTTCCCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000547.3-453s1c1
Sequence:CCGGGCTGAGCATCATTGCAAACATCTCGAGATGTTTGCAATGATGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000547.3-2566s1c1
Sequence:CCGGCCCTACGAGTTAGGAGACGATCTCGAGATCGTCTCCTAACTCGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000547.3-742s1c1
Sequence:CCGGGTCACAGATGATGACCGCTATCTCGAGATAGCGGTCATCATCTGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000547.3-1941s1c1
Sequence:CCGGCGACAAGATCCTGGACTTGTACTCGAGTACAAGTCCAGGATCTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000547
TPO MISSION shRNA Lentiviral Transduction Particles
thyroid peroxidase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000547.5-1493s21c1
Sequence:CCGGGGTCCCTATGAAGGCTATGACCTCGAGGTCATAGCCTTCATAGGGACCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000437890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000547.5-2710s21c1
Sequence:CCGGGACACGCACTGGCACTAAATCCTCGAGGATTTAGTGCCAGTGCGTGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000432869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000547.5-2975s21c1
Sequence:CCGGGAAATCAGCAGGACGACTGTTCTCGAGAACAGTCGTCCTGCTGATTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000429677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000547.5-1430s21c1
Sequence:CCGGATCATCACCCTGAGGGATTACCTCGAGGTAATCCCTCAGGGTGATGATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000446547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000547.5-1767s21c1
Sequence:CCGGAGCTGACGGAAAGGCTCTTTGCTCGAGCAAAGAGCCTTTCCGTCAGCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000418409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000547.5-2958s21c1
Sequence:CCGGCAAACACAGGCAAATCCGAAACTCGAGTTTCGGATTTGCCTGTGTTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000547.3-155s1c1
Sequence:CCGGCGAGAGGGAAAGAACTCCTTTCTCGAGAAAGGAGTTCTTTCCCTCTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000547.3-453s1c1
Sequence:CCGGGCTGAGCATCATTGCAAACATCTCGAGATGTTTGCAATGATGCTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000547.3-2566s1c1
Sequence:CCGGCCCTACGAGTTAGGAGACGATCTCGAGATCGTCTCCTAACTCGTAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000547.3-742s1c1
Sequence:CCGGGTCACAGATGATGACCGCTATCTCGAGATAGCGGTCATCATCTGTGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000547.3-1941s1c1
Sequence:CCGGCGACAAGATCCTGGACTTGTACTCGAGTACAAGTCCAGGATCTTGTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009417
TPO MISSION shRNA Bacterial Glycerol Stock
thyroid peroxidase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009417.2-1018s1c1
Sequence:CCGGCCTTGATGCTTCCACTGTGTACTCGAGTACACAGTGGAAGCATCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009417.2-230s1c1
Sequence:CCGGGCAGTCTACAACACCATGAAACTCGAGTTTCATGGTGTTGTAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009417.2-2411s1c1
Sequence:CCGGCCTGTCTGTAAAGATGTTAATCTCGAGATTAACATCTTTACAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009417.2-1892s1c1
Sequence:CCGGGTCAACAAGATAATGGACTTACTCGAGTAAGTCCATTATCTTGTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009417.2-416s1c1
Sequence:CCGGGCAGACATTCTGGGCACAATTCTCGAGAATTGTGCCCAGAATGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009417
TPO MISSION shRNA shRNA Plasmid DNA
thyroid peroxidase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009417.2-1018s1c1
Sequence:CCGGCCTTGATGCTTCCACTGTGTACTCGAGTACACAGTGGAAGCATCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009417.2-230s1c1
Sequence:CCGGGCAGTCTACAACACCATGAAACTCGAGTTTCATGGTGTTGTAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009417.2-2411s1c1
Sequence:CCGGCCTGTCTGTAAAGATGTTAATCTCGAGATTAACATCTTTACAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009417.2-1892s1c1
Sequence:CCGGGTCAACAAGATAATGGACTTACTCGAGTAAGTCCATTATCTTGTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009417.2-416s1c1
Sequence:CCGGGCAGACATTCTGGGCACAATTCTCGAGAATTGTGCCCAGAATGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009417
TPO MISSION shRNA Lentiviral Transduction Particles
thyroid peroxidase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009417.2-1018s1c1
Sequence:CCGGCCTTGATGCTTCCACTGTGTACTCGAGTACACAGTGGAAGCATCAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000066773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009417.2-230s1c1
Sequence:CCGGGCAGTCTACAACACCATGAAACTCGAGTTTCATGGTGTTGTAGACTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000066774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009417.2-2411s1c1
Sequence:CCGGCCTGTCTGTAAAGATGTTAATCTCGAGATTAACATCTTTACAGACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000066777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009417.2-1892s1c1
Sequence:CCGGGTCAACAAGATAATGGACTTACTCGAGTAAGTCCATTATCTTGTTGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000066775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009417.2-416s1c1
Sequence:CCGGGCAGACATTCTGGGCACAATTCTCGAGAATTGTGCCCAGAATGTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???