EMAIL THIS PAGE TO A FRIEND

TRIM22

tripartite motif containing 22

33 Gene Product Result for
Synonyms: GPSTAF50 RNF94 STAF50
UniProtKB ID: Q8IYM9, Q05CQ0, Q15521
Gene ID:
Human(10346) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to the cytoplasm and its expression is induced by interferon. The protein down-regulates transcription from the HIV-1 LTR promoter region, suggesting that function of this protein may be to mediate interferon's antiviral effects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
dog(485284) tripartite motif containing 22
domestic cat(101082007) tripartite motif containing 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006074 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006074 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006074 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067921 MISSION® esiRNA esiRNA human TRIM22 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006074 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244095 predicted 1303
2 SASI_Hs01_00244096 predicted 665
3 SASI_Hs01_00244097 predicted 1542
4 SASI_Hs01_00244098 predicted 655
5 SASI_Hs01_00244099 predicted 1341
6 SASI_Hs01_00244103 predicted 832
7 SASI_Hs01_00244104 predicted 1079
8 SASI_Hs02_00340844 predicted 814
9 SASI_Hs02_00340845 predicted 788
10 SASI_Hs01_00244102 predicted 1096
11 SASI_Hs01_00244100 predicted 342
12 SASI_Hs01_00244101 predicted 632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006074
TRIM22 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 22
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006074.2-1495s1c1
Sequence:CCGGCGGAGCACTCATCTACAAGTTCTCGAGAACTTGTAGATGAGTGCTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006074.2-671s1c1
Sequence:CCGGCAATGAAATGAGAGTCATCTTCTCGAGAAGATGACTCTCATTTCATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006074.2-502s1c1
Sequence:CCGGGTCACCAAACATTCCGCATAACTCGAGTTATGCGGAATGTTTGGTGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006074.2-1304s1c1
Sequence:CCGGCTCCAGATATAGACCTCAATACTCGAGTATTGAGGTCTATATCTGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006074.3-2777s21c1
Sequence:CCGGTATTGGTGTTCAAGACTATATCTCGAGATATAGTCTTGAACACCAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006074.3-1702s21c1
Sequence:CCGGTCGACCTGCTTATCCGTATTTCTCGAGAAATACGGATAAGCAGGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006074.3-783s21c1
Sequence:CCGGGAACCGCCTGGAAGAATTATACTCGAGTATAATTCTTCCAGGCGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006074.3-1251s21c1
Sequence:CCGGCTGTACGCACCTGCACATTTACTCGAGTAAATGTGCAGGTGCGTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006074.3-1305s21c1
Sequence:CCGGGTGTCTTCGGCTGCCAATATTCTCGAGAATATTGGCAGCCGAAGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006074
TRIM22 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 22
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006074.2-1495s1c1
Sequence:CCGGCGGAGCACTCATCTACAAGTTCTCGAGAACTTGTAGATGAGTGCTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006074.2-671s1c1
Sequence:CCGGCAATGAAATGAGAGTCATCTTCTCGAGAAGATGACTCTCATTTCATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006074.2-502s1c1
Sequence:CCGGGTCACCAAACATTCCGCATAACTCGAGTTATGCGGAATGTTTGGTGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006074.2-1304s1c1
Sequence:CCGGCTCCAGATATAGACCTCAATACTCGAGTATTGAGGTCTATATCTGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006074.3-2777s21c1
Sequence:CCGGTATTGGTGTTCAAGACTATATCTCGAGATATAGTCTTGAACACCAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006074.3-1702s21c1
Sequence:CCGGTCGACCTGCTTATCCGTATTTCTCGAGAAATACGGATAAGCAGGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006074.3-783s21c1
Sequence:CCGGGAACCGCCTGGAAGAATTATACTCGAGTATAATTCTTCCAGGCGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006074.3-1251s21c1
Sequence:CCGGCTGTACGCACCTGCACATTTACTCGAGTAAATGTGCAGGTGCGTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006074.3-1305s21c1
Sequence:CCGGGTGTCTTCGGCTGCCAATATTCTCGAGAATATTGGCAGCCGAAGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006074
TRIM22 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 22
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006074.2-1495s1c1
Sequence:CCGGCGGAGCACTCATCTACAAGTTCTCGAGAACTTGTAGATGAGTGCTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006074.2-671s1c1
Sequence:CCGGCAATGAAATGAGAGTCATCTTCTCGAGAAGATGACTCTCATTTCATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006074.2-502s1c1
Sequence:CCGGGTCACCAAACATTCCGCATAACTCGAGTTATGCGGAATGTTTGGTGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006074.2-1304s1c1
Sequence:CCGGCTCCAGATATAGACCTCAATACTCGAGTATTGAGGTCTATATCTGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006074.3-2777s21c1
Sequence:CCGGTATTGGTGTTCAAGACTATATCTCGAGATATAGTCTTGAACACCAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006074.3-1702s21c1
Sequence:CCGGTCGACCTGCTTATCCGTATTTCTCGAGAAATACGGATAAGCAGGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006074.3-783s21c1
Sequence:CCGGGAACCGCCTGGAAGAATTATACTCGAGTATAATTCTTCCAGGCGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006074.3-1251s21c1
Sequence:CCGGCTGTACGCACCTGCACATTTACTCGAGTAAATGTGCAGGTGCGTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006074.3-1305s21c1
Sequence:CCGGGTGTCTTCGGCTGCCAATATTCTCGAGAATATTGGCAGCCGAAGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)