EMAIL THIS PAGE TO A FRIEND

TRIM43

tripartite motif containing 43

26 Gene Product Result for
Synonyms: TRIM43A
Species: Human TRIM43(129868)
UniProtKB ID: Q96BQ3, Q53TJ7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138800 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138800 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138800 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111151 MISSION® esiRNA esiRNA human TRIM43 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138800 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231251 predicted 662
2 SASI_Hs02_00363953 predicted 1204
3 SASI_Hs01_00231252 predicted 539
4 SASI_Hs01_00231253 predicted 820
5 SASI_Hs01_00231255 predicted 545
6 SASI_Hs01_00231256 predicted 990
7 SASI_Hs01_00231258 predicted 507
8 SASI_Hs01_00231260 predicted 739
9 SASI_Hs02_00363954 predicted 611
10 SASI_Hs02_00363955 predicted 1159
11 SASI_Hs01_00231254 predicted 836
12 SASI_Hs01_00231257 predicted 834
13 SASI_Hs01_00231259 predicted 670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138800
TRIM43 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 43
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138800.1-699s1c1
Sequence:CCGGCGGTTCTCCATAAGGAAGAAACTCGAGTTTCTTCCTTATGGAGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138800.1-1024s1c1
Sequence:CCGGCAATCACAATATCAGGCTCTTCTCGAGAAGAGCCTGATATTGTGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138800.1-1129s1c1
Sequence:CCGGCTTCTCCTTTGGGAAACACTACTCGAGTAGTGTTTCCCAAAGGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138800.1-1267s1c1
Sequence:CCGGGAAGGTGGATAATCATTTCAACTCGAGTTGAAATGATTATCCACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138800.1-985s21c1
Sequence:CCGGCCGCTTCCGAGTGGAAATTTCCTCGAGGAAATTTCCACTCGGAAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138800.1-1231s21c1
Sequence:CCGGGGTTAACTCTGAGGACATATTCTCGAGAATATGTCCTCAGAGTTAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138800
TRIM43 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 43
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138800.1-699s1c1
Sequence:CCGGCGGTTCTCCATAAGGAAGAAACTCGAGTTTCTTCCTTATGGAGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138800.1-1024s1c1
Sequence:CCGGCAATCACAATATCAGGCTCTTCTCGAGAAGAGCCTGATATTGTGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138800.1-1129s1c1
Sequence:CCGGCTTCTCCTTTGGGAAACACTACTCGAGTAGTGTTTCCCAAAGGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138800.1-1267s1c1
Sequence:CCGGGAAGGTGGATAATCATTTCAACTCGAGTTGAAATGATTATCCACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138800.1-985s21c1
Sequence:CCGGCCGCTTCCGAGTGGAAATTTCCTCGAGGAAATTTCCACTCGGAAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138800.1-1231s21c1
Sequence:CCGGGGTTAACTCTGAGGACATATTCTCGAGAATATGTCCTCAGAGTTAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138800
TRIM43 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 43
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138800.1-699s1c1
Sequence:CCGGCGGTTCTCCATAAGGAAGAAACTCGAGTTTCTTCCTTATGGAGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138800.1-1024s1c1
Sequence:CCGGCAATCACAATATCAGGCTCTTCTCGAGAAGAGCCTGATATTGTGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138800.1-1129s1c1
Sequence:CCGGCTTCTCCTTTGGGAAACACTACTCGAGTAGTGTTTCCCAAAGGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138800.1-1267s1c1
Sequence:CCGGGAAGGTGGATAATCATTTCAACTCGAGTTGAAATGATTATCCACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138800.1-985s21c1
Sequence:CCGGCCGCTTCCGAGTGGAAATTTCCTCGAGGAAATTTCCACTCGGAAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138800.1-1231s21c1
Sequence:CCGGGGTTAACTCTGAGGACATATTCTCGAGAATATGTCCTCAGAGTTAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)