EMAIL THIS PAGE TO A FRIEND

TRIP6

thyroid hormone receptor interactor 6

48 Gene Product Result for
Synonyms: OIP-1 OIP1 TRIP-6 TRIP6i2 ZRP-1
Gene ID:
Human(7205) Summary: This gene is a member of the zyxin family and encodes a protein with three LIM zinc-binding domains. This protein localizes to focal adhesion sites and along actin stress fibers. Recruitment of this protein to the plasma membrane occurs in a lysophosphatidic acid (LPA)-dependent manner and it regulates LPA-induced cell migration. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
Mouse(22051) thyroid hormone receptor interactor 6
Rat(686323) thyroid hormone receptor interactor 6
dog(479732) thyroid hormone receptor interactor 6
domestic cat(101094469) thyroid hormone receptor interactor 6
cow(615869) thyroid hormone receptor interactor 6
sheep(101120629) thyroid hormone receptor interactor 6
naked mole-rat(101707164) thyroid hormone receptor interactor 6
domestic guinea pig(100733129) thyroid hormone receptor interactor 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV51617 Anti-TRIP6 (AB1) antibody produced in rabbit affinity isolated antibody rat, horse, pig, human, bovine
western blot pricing
AV51618 Anti-TRIP6 (AB2) antibody produced in rabbit affinity isolated antibody mouse, guinea pig, human, horse, rat
western blot pricing
SAB2501637 Anti-TRIP6 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, bovine
ELISA, western blot pricing
SAB3500567 Anti-TRIP6 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
HPA052813 Anti-TRIP6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
WH0007205M4 Monoclonal Anti-TRIP6 antibody produced in mouse clone 4B7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB4200014 Monoclonal Anti-TRIP6 antibody produced in mouse ~1.0 mg/mL, clone TRP(N)-12, purified immunoglobulin, buffered aqueous solution bovine, human
western blot pricing
SAB4200015 Monoclonal Anti-TRIP6 antibody produced in mouse ~1.0 mg/mL, clone TRP(C)-34, purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1404492 Monoclonal Anti-TRIP6, (N-terminal) antibody produced in mouse clone 3D12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003302 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003302 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003302 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011639 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011639 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011639 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003302 Rosetta Predictions human pricing
NM_001127570 Rosetta Predictions rat pricing
NM_011639 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003302 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014553 predicted 947
2 SASI_Hs01_00014554 predicted 1098
3 SASI_Hs01_00014555 predicted 453
4 SASI_Hs01_00014556 predicted 1442
5 SASI_Hs01_00014558 predicted 1294
6 SASI_Hs01_00014559 predicted 992
7 SASI_Hs01_00014560 predicted 929
8 SASI_Hs01_00014561 predicted 1151
9 SASI_Hs01_00014562 predicted 623
10 SASI_Hs02_00335398 predicted 516
11 SASI_Hs01_00014557 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127570 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254453 predicted 410
2 SASI_Rn02_00254454 predicted 1312
3 SASI_Rn02_00254455 predicted 417
4 SASI_Rn02_00254456 predicted 609
5 SASI_Rn02_00254457 predicted 1131
6 SASI_Rn02_00254458 predicted 1197
7 SASI_Rn02_00254459 predicted 1289
8 SASI_Rn02_00254460 predicted 1069
9 SASI_Rn02_00254461 predicted 1166
10 SASI_Rn02_00254462 predicted 1408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011639 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086491 predicted 1289
2 SASI_Mm01_00086492 predicted 577
3 SASI_Mm01_00086493 predicted 1280
4 SASI_Mm01_00086494 predicted 1141
5 SASI_Mm01_00086495 predicted 1222
6 SASI_Mm01_00086496 predicted 856
7 SASI_Mm01_00086497 predicted 1185
8 SASI_Mm01_00086498 predicted 1084
9 SASI_Mm01_00086499 predicted 1028
10 SASI_Mm02_00321093 predicted 1332
11 SASI_Mm01_00086500 predicted 1195
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003302
VALIDATED
TRIP6 MISSION shRNA Bacterial Glycerol Stock
thyroid hormone receptor interactor 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003302.1-1321s1c1
Sequence:CCGGGTGAGAATTGTTGCTCTGGATCTCGAGATCCAGAGCAACAATTCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003302.2-314s21c1
Sequence:CCGGCCTTCCATCTGAGCAGTGTTACTCGAGTAACACTGCTCAGATGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003302.1-858s1c1
Sequence:CCGGGAAGCTGGTTCACGACATGAACTCGAGTTCATGTCGTGAACCAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003302.1-983s1c1
Sequence:CCGGGCTGCTTTGTATGTTCTACATCTCGAGATGTAGAACATACAAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003302.1-219s1c1
Sequence:CCGGCCTTCCATCTGAGCAGTGTTACTCGAGTAACACTGCTCAGATGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003302.1-1312s1c1
Sequence:CCGGGAGGAGACTGTGAGAATTGTTCTCGAGAACAATTCTCACAGTCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003302.2-1407s21c1
Sequence:CCGGGAGGAGACTGTGAGAATTGTTCTCGAGAACAATTCTCACAGTCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003302.2-1078s21c1
Sequence:CCGGGCTGCTTTGTATGTTCTACATCTCGAGATGTAGAACATACAAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003302.2-953s21c1
Sequence:CCGGGAAGCTGGTTCACGACATGAACTCGAGTTCATGTCGTGAACCAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003302
VALIDATED
TRIP6 MISSION shRNA shRNA Plasmid DNA
thyroid hormone receptor interactor 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003302.1-1321s1c1
Sequence:CCGGGTGAGAATTGTTGCTCTGGATCTCGAGATCCAGAGCAACAATTCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003302.2-314s21c1
Sequence:CCGGCCTTCCATCTGAGCAGTGTTACTCGAGTAACACTGCTCAGATGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003302.1-858s1c1
Sequence:CCGGGAAGCTGGTTCACGACATGAACTCGAGTTCATGTCGTGAACCAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003302.1-983s1c1
Sequence:CCGGGCTGCTTTGTATGTTCTACATCTCGAGATGTAGAACATACAAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003302.1-219s1c1
Sequence:CCGGCCTTCCATCTGAGCAGTGTTACTCGAGTAACACTGCTCAGATGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003302.1-1312s1c1
Sequence:CCGGGAGGAGACTGTGAGAATTGTTCTCGAGAACAATTCTCACAGTCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003302.2-1407s21c1
Sequence:CCGGGAGGAGACTGTGAGAATTGTTCTCGAGAACAATTCTCACAGTCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003302.2-1078s21c1
Sequence:CCGGGCTGCTTTGTATGTTCTACATCTCGAGATGTAGAACATACAAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003302.2-953s21c1
Sequence:CCGGGAAGCTGGTTCACGACATGAACTCGAGTTCATGTCGTGAACCAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003302
VALIDATED
TRIP6 MISSION shRNA Lentiviral Transduction Particles
thyroid hormone receptor interactor 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003302.1-1321s1c1
Sequence:CCGGGTGAGAATTGTTGCTCTGGATCTCGAGATCCAGAGCAACAATTCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003302.2-314s21c1
Sequence:CCGGCCTTCCATCTGAGCAGTGTTACTCGAGTAACACTGCTCAGATGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003302.1-858s1c1
Sequence:CCGGGAAGCTGGTTCACGACATGAACTCGAGTTCATGTCGTGAACCAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003302.1-983s1c1
Sequence:CCGGGCTGCTTTGTATGTTCTACATCTCGAGATGTAGAACATACAAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003302.1-219s1c1
Sequence:CCGGCCTTCCATCTGAGCAGTGTTACTCGAGTAACACTGCTCAGATGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003302.1-1312s1c1
Sequence:CCGGGAGGAGACTGTGAGAATTGTTCTCGAGAACAATTCTCACAGTCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003302.2-1407s21c1
Sequence:CCGGGAGGAGACTGTGAGAATTGTTCTCGAGAACAATTCTCACAGTCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003302.2-1078s21c1
Sequence:CCGGGCTGCTTTGTATGTTCTACATCTCGAGATGTAGAACATACAAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003302.2-953s21c1
Sequence:CCGGGAAGCTGGTTCACGACATGAACTCGAGTTCATGTCGTGAACCAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011639
VALIDATED
TRIP6 MISSION shRNA Bacterial Glycerol Stock
thyroid hormone receptor interactor 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011639.3-1440s21c1
Sequence:CCGGGTTGCTCTGGATCGAAGTTTCCTCGAGGAAACTTCGATCCAGAGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011639.2-1072s1c1
Sequence:CCGGCTGGACCGTGTCTTCCATATTCTCGAGAATATGGAAGACACGGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011639.2-1595s1c1
Sequence:CCGGCCACTGTCACCACTGATTGTTCTCGAGAACAATCAGTGGTGACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011639.2-1080s1c1
Sequence:CCGGTGTCTTCCATATTGGTTGCTTCTCGAGAAGCAACCAATATGGAAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011639.2-1190s1c1
Sequence:CCGGCCCTGGAGAAATGTTCCACATCTCGAGATGTGGAACATTTCTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011639.2-449s1c1
Sequence:CCGGGTCTGGATGCTGAGATAGATTCTCGAGAATCTATCTCAGCATCCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011639.3-1337s21c1
Sequence:CCGGGATCCACTGCATTGAAGATTTCTCGAGAAATCTTCAATGCAGTGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011639.3-860s21c1
Sequence:CCGGGGGACCTTCTGGAGTACATATCTCGAGATATGTACTCCAGAAGGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011639.3-318s21c1
Sequence:CCGGCTCCCGCCTGAACACTGTTATCTCGAGATAACAGTGTTCAGGCGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011639.3-952s21c1
Sequence:CCGGTGGAGAGACTGACCAAGAAACCTCGAGGTTTCTTGGTCAGTCTCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011639
VALIDATED
TRIP6 MISSION shRNA shRNA Plasmid DNA
thyroid hormone receptor interactor 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011639.3-1440s21c1
Sequence:CCGGGTTGCTCTGGATCGAAGTTTCCTCGAGGAAACTTCGATCCAGAGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011639.2-1072s1c1
Sequence:CCGGCTGGACCGTGTCTTCCATATTCTCGAGAATATGGAAGACACGGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011639.2-1595s1c1
Sequence:CCGGCCACTGTCACCACTGATTGTTCTCGAGAACAATCAGTGGTGACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011639.2-1080s1c1
Sequence:CCGGTGTCTTCCATATTGGTTGCTTCTCGAGAAGCAACCAATATGGAAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011639.2-1190s1c1
Sequence:CCGGCCCTGGAGAAATGTTCCACATCTCGAGATGTGGAACATTTCTCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011639.2-449s1c1
Sequence:CCGGGTCTGGATGCTGAGATAGATTCTCGAGAATCTATCTCAGCATCCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011639.3-1337s21c1
Sequence:CCGGGATCCACTGCATTGAAGATTTCTCGAGAAATCTTCAATGCAGTGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011639.3-860s21c1
Sequence:CCGGGGGACCTTCTGGAGTACATATCTCGAGATATGTACTCCAGAAGGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011639.3-318s21c1
Sequence:CCGGCTCCCGCCTGAACACTGTTATCTCGAGATAACAGTGTTCAGGCGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011639.3-952s21c1
Sequence:CCGGTGGAGAGACTGACCAAGAAACCTCGAGGTTTCTTGGTCAGTCTCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011639
VALIDATED
TRIP6 MISSION shRNA Lentiviral Transduction Particles
thyroid hormone receptor interactor 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011639.3-1440s21c1
Sequence:CCGGGTTGCTCTGGATCGAAGTTTCCTCGAGGAAACTTCGATCCAGAGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011639.2-1072s1c1
Sequence:CCGGCTGGACCGTGTCTTCCATATTCTCGAGAATATGGAAGACACGGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011639.2-1595s1c1
Sequence:CCGGCCACTGTCACCACTGATTGTTCTCGAGAACAATCAGTGGTGACAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011639.2-1080s1c1
Sequence:CCGGTGTCTTCCATATTGGTTGCTTCTCGAGAAGCAACCAATATGGAAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011639.2-1190s1c1
Sequence:CCGGCCCTGGAGAAATGTTCCACATCTCGAGATGTGGAACATTTCTCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011639.2-449s1c1
Sequence:CCGGGTCTGGATGCTGAGATAGATTCTCGAGAATCTATCTCAGCATCCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011639.3-1337s21c1
Sequence:CCGGGATCCACTGCATTGAAGATTTCTCGAGAAATCTTCAATGCAGTGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011639.3-860s21c1
Sequence:CCGGGGGACCTTCTGGAGTACATATCTCGAGATATGTACTCCAGAAGGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011639.3-318s21c1
Sequence:CCGGCTCCCGCCTGAACACTGTTATCTCGAGATAACAGTGTTCAGGCGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011639.3-952s21c1
Sequence:CCGGTGGAGAGACTGACCAAGAAACCTCGAGGTTTCTTGGTCAGTCTCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)