EMAIL THIS PAGE TO A FRIEND

Trp53

32 Gene Product Result for
Species: Mouse Trp53(22059)
Gene ID:
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
P4235 Anti-p53 antibody produced in sheep fractionated antiserum, buffered aqueous solution mouse, human, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
P8982 Anti-phospho-p53 (pSer392) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution mouse, human
microarray, western blot pricing
SAB2106418 Anti-TRP53 antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0115 CP-31398 dihydrochloride hydrate ≥98% (HPLC) human, mouse, rat pricing

ELISA

Product # Description Species Add to Cart
 
RAB0835 Mouse Trp53 / Cellular Tumor Antigen p53 ELISA Kit mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011640 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011640 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011640 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127233 Rosetta Predictions mouse pricing
NM_011640 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127233 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310137 predicted 839
2 SASI_Mm02_00310138 predicted 836
3 SASI_Mm02_00310139 predicted 326
4 SASI_Mm02_00310140 predicted 235
5 SASI_Mm02_00310141 predicted 1018
6 SASI_Mm02_00310142 predicted 964
7 SASI_Mm02_00310143 predicted 888
8 SASI_Mm02_00310144 predicted 643
9 SASI_Mm02_00310145 predicted 893
10 SASI_Mm02_00310146 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011640 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080292 predicted 834
2 SASI_Mm01_00080293 predicted 843
3 SASI_Mm01_00080297 predicted 317
4 SASI_Mm02_00321094 predicted 236
5 SASI_Mm02_00321095 predicted 1023
6 SASI_Mm02_00321096 predicted 959
7 SASI_Mm02_00321097 predicted 889
8 SASI_Mm02_00321098 predicted 648
9 SASI_Mm02_00321099 predicted 889
10 SASI_Mm02_00321100 predicted 358
11 SASI_Mm01_00080291 predicted 1516
12 SASI_Mm01_00080294 predicted 1555
13 SASI_Mm01_00080295 predicted 1491
14 SASI_Mm01_00080296 predicted 1496
15 SASI_Mm01_00080298 predicted 1650
16 SASI_Mm01_00080299 predicted 1335
17 SASI_Mm01_00080300 predicted 1262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011640
VALIDATED
Trp53 MISSION shRNA Bacterial Glycerol Stock
Mouse
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1526s1c1
Sequence:CCGGCGGGCGTAAACGCTTCGAGATCTCGAGATCTCGAAGCGTTTACGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1502s1c1
Sequence:CCGGAGAGTATTTCACCCTCAAGATCTCGAGATCTTGAGGGTGAAATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011640.1-1944s1c1
Sequence:CCGGCTACAATGAAATCTCACCCTACTCGAGTAGGGTGAGATTTCATTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1369s1c1
Sequence:CCGGACCGCCGTACAGAAGAAGAAACTCGAGTTTCTTCTTCTGTACGGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1649s1c1
Sequence:CCGGCCAGTCTACTTCCCGCCATAACTCGAGTTATGGCGGGAAGTAGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1013s1c1
Sequence:CCGGCTACAAGAAGTCACAGCACATCTCGAGATGTGCTGTGACTTCTTGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011640.1-1908s1c1
Sequence:CCGGCGAAATTCTATCCAGCCAGTTCTCGAGAACTGGCTGGATAGAATTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1223s1c1
Sequence:CCGGCCACTACAAGTACATGTGTAACTCGAGTTACACATGTACTTGTAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-625s1c1
Sequence:CCGGCTCCAGAAGATATCCTGCCATCTCGAGATGGCAGGATATCTTCTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011640.3-246s21c1
Sequence:CCGGCTCCAGAAGATATCCTGCCATCTCGAGATGGCAGGATATCTTCTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1526s1c2
Sequence:CCGGCGGGCGTAAACGCTTCGAGATCTCGAGATCTCGAAGCGTTTACGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1526s1c3
Sequence:CCGGCGGGCGTAAACGCTTCGAGATCTCGAGATCTCGAAGCGTTTACGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011640.3-1147s21c1
Sequence:CCGGCGGGCGTAAACGCTTCGAGATCTCGAGATCTCGAAGCGTTTACGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011640.3-844s21c1
Sequence:CCGGCCACTACAAGTACATGTGTAACTCGAGTTACACATGTACTTGTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304241    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011640.3-1589s21c1
Sequence:CCGGCACACCCTGTAAGATTCTATCCTCGAGGATAGAATCTTACAGGGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011640.3-634s21c1
Sequence:CCGGCTACAAGAAGTCACAGCACATCTCGAGATGTGCTGTGACTTCTTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011640
VALIDATED
Trp53 MISSION shRNA shRNA Plasmid DNA
Mouse
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1526s1c1
Sequence:CCGGCGGGCGTAAACGCTTCGAGATCTCGAGATCTCGAAGCGTTTACGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1502s1c1
Sequence:CCGGAGAGTATTTCACCCTCAAGATCTCGAGATCTTGAGGGTGAAATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011640.1-1944s1c1
Sequence:CCGGCTACAATGAAATCTCACCCTACTCGAGTAGGGTGAGATTTCATTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1369s1c1
Sequence:CCGGACCGCCGTACAGAAGAAGAAACTCGAGTTTCTTCTTCTGTACGGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1649s1c1
Sequence:CCGGCCAGTCTACTTCCCGCCATAACTCGAGTTATGGCGGGAAGTAGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1013s1c1
Sequence:CCGGCTACAAGAAGTCACAGCACATCTCGAGATGTGCTGTGACTTCTTGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011640.1-1908s1c1
Sequence:CCGGCGAAATTCTATCCAGCCAGTTCTCGAGAACTGGCTGGATAGAATTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1223s1c1
Sequence:CCGGCCACTACAAGTACATGTGTAACTCGAGTTACACATGTACTTGTAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-625s1c1
Sequence:CCGGCTCCAGAAGATATCCTGCCATCTCGAGATGGCAGGATATCTTCTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011640.3-246s21c1
Sequence:CCGGCTCCAGAAGATATCCTGCCATCTCGAGATGGCAGGATATCTTCTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1526s1c2
Sequence:CCGGCGGGCGTAAACGCTTCGAGATCTCGAGATCTCGAAGCGTTTACGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1526s1c3
Sequence:CCGGCGGGCGTAAACGCTTCGAGATCTCGAGATCTCGAAGCGTTTACGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011640.3-1147s21c1
Sequence:CCGGCGGGCGTAAACGCTTCGAGATCTCGAGATCTCGAAGCGTTTACGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011640.3-844s21c1
Sequence:CCGGCCACTACAAGTACATGTGTAACTCGAGTTACACATGTACTTGTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304241    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011640.3-1589s21c1
Sequence:CCGGCACACCCTGTAAGATTCTATCCTCGAGGATAGAATCTTACAGGGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011640.3-634s21c1
Sequence:CCGGCTACAAGAAGTCACAGCACATCTCGAGATGTGCTGTGACTTCTTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011640
VALIDATED
Trp53 MISSION shRNA Lentiviral Transduction Particles
Mouse
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1526s1c1
Sequence:CCGGCGGGCGTAAACGCTTCGAGATCTCGAGATCTCGAAGCGTTTACGCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1502s1c1
Sequence:CCGGAGAGTATTTCACCCTCAAGATCTCGAGATCTTGAGGGTGAAATACTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011640.1-1944s1c1
Sequence:CCGGCTACAATGAAATCTCACCCTACTCGAGTAGGGTGAGATTTCATTGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1369s1c1
Sequence:CCGGACCGCCGTACAGAAGAAGAAACTCGAGTTTCTTCTTCTGTACGGCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1649s1c1
Sequence:CCGGCCAGTCTACTTCCCGCCATAACTCGAGTTATGGCGGGAAGTAGACTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1013s1c1
Sequence:CCGGCTACAAGAAGTCACAGCACATCTCGAGATGTGCTGTGACTTCTTGTAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011640.1-1908s1c1
Sequence:CCGGCGAAATTCTATCCAGCCAGTTCTCGAGAACTGGCTGGATAGAATTTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1223s1c1
Sequence:CCGGCCACTACAAGTACATGTGTAACTCGAGTTACACATGTACTTGTAGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-625s1c1
Sequence:CCGGCTCCAGAAGATATCCTGCCATCTCGAGATGGCAGGATATCTTCTGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011640.3-246s21c1
Sequence:CCGGCTCCAGAAGATATCCTGCCATCTCGAGATGGCAGGATATCTTCTGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1526s1c2
Sequence:CCGGCGGGCGTAAACGCTTCGAGATCTCGAGATCTCGAAGCGTTTACGCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011640.1-1526s1c3
Sequence:CCGGCGGGCGTAAACGCTTCGAGATCTCGAGATCTCGAAGCGTTTACGCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011640.3-1147s21c1
Sequence:CCGGCGGGCGTAAACGCTTCGAGATCTCGAGATCTCGAAGCGTTTACGCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011640.3-844s21c1
Sequence:CCGGCCACTACAAGTACATGTGTAACTCGAGTTACACATGTACTTGTAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304241    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011640.3-1589s21c1
Sequence:CCGGCACACCCTGTAAGATTCTATCCTCGAGGATAGAATCTTACAGGGTGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011640.3-634s21c1
Sequence:CCGGCTACAAGAAGTCACAGCACATCTCGAGATGTGCTGTGACTTCTTGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)