EMAIL THIS PAGE TO A FRIEND

Trp53inp1

12 Gene Product Result for
Species: Mouse Trp53inp1(60599)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
P4868 Anti-p53DINP1/SIP antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat, mouse
microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021897 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021897 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021897 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU087641 MISSION® esiRNA esiRNA targeting mouse Trp53inp1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021897 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038382 predicted 347
2 SASI_Mm01_00038383 predicted 594
3 SASI_Mm01_00038384 predicted 462
4 SASI_Mm01_00038385 predicted 503
5 SASI_Mm01_00038386 predicted 290
6 SASI_Mm01_00038387 predicted 889
7 SASI_Mm01_00038388 predicted 678
8 SASI_Mm01_00038389 predicted 955
9 SASI_Mm01_00038390 predicted 987
10 SASI_Mm01_00038391 predicted 957
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021897
VALIDATED
Trp53inp1 MISSION shRNA Bacterial Glycerol Stock
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021897.1-687s1c1
Sequence:CCGGGAGTTGTGGAAATGATGAATACTCGAGTATTCATCATTTCCACAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021897.1-858s1c1
Sequence:CCGGGTCTTTGAACAGAAATGGTCTCTCGAGAGACCATTTCTGTTCAAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021897.1-479s1c1
Sequence:CCGGGCTTGACTGACACCAGTGATTCTCGAGAATCACTGGTGTCAGTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021897.3-478s21c1
Sequence:CCGGGCTTGACTGACACCAGTGATTCTCGAGAATCACTGGTGTCAGTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021897.3-684s21c1
Sequence:CCGGGCGAGTTGTGGAAATGATGAACTCGAGTTCATCATTTCCACAACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021897.3-841s21c1
Sequence:CCGGGACACAGTGAAAGACAGTCTTCTCGAGAAGACTGTCTTTCACTGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021897.3-857s21c1
Sequence:CCGGGTCTTTGAACAGAAATGGTCTCTCGAGAGACCATTTCTGTTCAAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021897.3-5152s21c1
Sequence:CCGGGCCACTATCTAATTGTTCTTTCTCGAGAAAGAACAATTAGATAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021897.1-2448s1c1
Sequence:CCGGCGCATATTCAAAGTGCTCATTCTCGAGAATGAGCACTTTGAATATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021897.1-685s1c1
Sequence:CCGGGCGAGTTGTGGAAATGATGAACTCGAGTTCATCATTTCCACAACTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021897.1-5155s1c1
Sequence:CCGGGCCACTATCTAATTGTTCTTTCTCGAGAAAGAACAATTAGATAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021897.1-842s1c1
Sequence:CCGGGACACAGTGAAAGACAGTCTTCTCGAGAAGACTGTCTTTCACTGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021897.1-1083s1c1
Sequence:CCGGGCCTAGTGTATCAGTGTGTTTCTCGAGAAACACACTGATACACTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021897
VALIDATED
Trp53inp1 MISSION shRNA shRNA Plasmid DNA
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021897.1-687s1c1
Sequence:CCGGGAGTTGTGGAAATGATGAATACTCGAGTATTCATCATTTCCACAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021897.1-858s1c1
Sequence:CCGGGTCTTTGAACAGAAATGGTCTCTCGAGAGACCATTTCTGTTCAAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021897.1-479s1c1
Sequence:CCGGGCTTGACTGACACCAGTGATTCTCGAGAATCACTGGTGTCAGTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021897.3-478s21c1
Sequence:CCGGGCTTGACTGACACCAGTGATTCTCGAGAATCACTGGTGTCAGTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021897.3-684s21c1
Sequence:CCGGGCGAGTTGTGGAAATGATGAACTCGAGTTCATCATTTCCACAACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021897.3-841s21c1
Sequence:CCGGGACACAGTGAAAGACAGTCTTCTCGAGAAGACTGTCTTTCACTGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021897.3-857s21c1
Sequence:CCGGGTCTTTGAACAGAAATGGTCTCTCGAGAGACCATTTCTGTTCAAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021897.3-5152s21c1
Sequence:CCGGGCCACTATCTAATTGTTCTTTCTCGAGAAAGAACAATTAGATAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021897.1-2448s1c1
Sequence:CCGGCGCATATTCAAAGTGCTCATTCTCGAGAATGAGCACTTTGAATATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021897.1-685s1c1
Sequence:CCGGGCGAGTTGTGGAAATGATGAACTCGAGTTCATCATTTCCACAACTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021897.1-5155s1c1
Sequence:CCGGGCCACTATCTAATTGTTCTTTCTCGAGAAAGAACAATTAGATAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021897.1-842s1c1
Sequence:CCGGGACACAGTGAAAGACAGTCTTCTCGAGAAGACTGTCTTTCACTGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021897.1-1083s1c1
Sequence:CCGGGCCTAGTGTATCAGTGTGTTTCTCGAGAAACACACTGATACACTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021897
VALIDATED
Trp53inp1 MISSION shRNA Lentiviral Transduction Particles
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021897.1-687s1c1
Sequence:CCGGGAGTTGTGGAAATGATGAATACTCGAGTATTCATCATTTCCACAACTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021897.1-858s1c1
Sequence:CCGGGTCTTTGAACAGAAATGGTCTCTCGAGAGACCATTTCTGTTCAAAGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021897.1-479s1c1
Sequence:CCGGGCTTGACTGACACCAGTGATTCTCGAGAATCACTGGTGTCAGTCAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021897.3-478s21c1
Sequence:CCGGGCTTGACTGACACCAGTGATTCTCGAGAATCACTGGTGTCAGTCAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021897.3-684s21c1
Sequence:CCGGGCGAGTTGTGGAAATGATGAACTCGAGTTCATCATTTCCACAACTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021897.3-841s21c1
Sequence:CCGGGACACAGTGAAAGACAGTCTTCTCGAGAAGACTGTCTTTCACTGTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021897.3-857s21c1
Sequence:CCGGGTCTTTGAACAGAAATGGTCTCTCGAGAGACCATTTCTGTTCAAAGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021897.3-5152s21c1
Sequence:CCGGGCCACTATCTAATTGTTCTTTCTCGAGAAAGAACAATTAGATAGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021897.1-2448s1c1
Sequence:CCGGCGCATATTCAAAGTGCTCATTCTCGAGAATGAGCACTTTGAATATGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021897.1-685s1c1
Sequence:CCGGGCGAGTTGTGGAAATGATGAACTCGAGTTCATCATTTCCACAACTCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021897.1-5155s1c1
Sequence:CCGGGCCACTATCTAATTGTTCTTTCTCGAGAAAGAACAATTAGATAGTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021897.1-842s1c1
Sequence:CCGGGACACAGTGAAAGACAGTCTTCTCGAGAAGACTGTCTTTCACTGTGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021897.1-1083s1c1
Sequence:CCGGGCCTAGTGTATCAGTGTGTTTCTCGAGAAACACACTGATACACTAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)