EMAIL THIS PAGE TO A FRIEND

TTLL8

tubulin tyrosine ligase-like family, member 8

38 Gene Product Result for
UniProtKB ID: A6PVC2
Gene ID:
Mouse(239591) tubulin tyrosine ligase-like family, member 8
dog(474461) tubulin tyrosine ligase-like family, member 8
domestic cat(101100574) tubulin tyrosine ligase-like family, member 8
Domestic Rabbit(100351625) tubulin tyrosine ligase-like family, member 8
naked mole-rat(101713442) tubulin tyrosine ligase-like family, member 8
domestic guinea pig(100726600) tubulin tyrosine ligase-like family, member 8
cow(100336501) tubulin tyrosine ligase-like family, member 8
sheep(101113929) tubulin tyrosine ligase-like family, member 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080447 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172818 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172818 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172818 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080447 Rosetta Predictions human pricing
XM_104657 Rosetta Predictions human pricing
NM_172818 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314926 predicted 842
2 SASI_Hs02_00314927 predicted 1224
3 SASI_Hs02_00314928 predicted 257
4 SASI_Hs02_00314929 predicted 305
5 SASI_Hs02_00314930 predicted 238
6 SASI_Hs02_00314931 predicted 358
7 SASI_Hs02_00314932 predicted 961
8 SASI_Hs02_00314933 predicted 949
9 SASI_Hs02_00314934 predicted 1213
10 SASI_Hs02_00314935 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_104657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248266 predicted 263
2 SASI_Hs01_00248267 predicted 316
3 SASI_Hs01_00248268 predicted 237
4 SASI_Hs01_00248269 predicted 372
5 SASI_Hs01_00248270 predicted 2107
6 SASI_Hs01_00248271 predicted 471
7 SASI_Hs01_00248272 predicted 342
8 SASI_Hs01_00248273 predicted 288
9 SASI_Hs01_00248274 predicted 247
10 SASI_Hs01_00248275 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172818 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091946 predicted 836
2 SASI_Mm01_00091947 predicted 1670
3 SASI_Mm01_00091948 predicted 2151
4 SASI_Mm01_00091949 predicted 2535
5 SASI_Mm01_00091950 predicted 2638
6 SASI_Mm01_00091951 predicted 2649
7 SASI_Mm01_00091952 predicted 520
8 SASI_Mm01_00091953 predicted 1358
9 SASI_Mm01_00091954 predicted 864
10 SASI_Mm01_00091955 predicted 2513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080447
TTLL8 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080447.1-258s21c1
Sequence:CCGGCGTGATGTCTAGGTTGGTAAACTCGAGTTTACCAACCTAGACATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080447.1-2108s21c1
Sequence:CCGGGGGATCCAAACCAGCTAAATGCTCGAGCATTTAGCTGGTTTGGATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080447.1-981s21c1
Sequence:CCGGCCGGAACATCTGGATTATAAACTCGAGTTTATAATCCAGATGTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080447.1-1559s21c1
Sequence:CCGGCCTGGCTGATCGAGATCAATTCTCGAGAATTGATCTCGATCAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080447.1-874s21c1
Sequence:CCGGCAGAAGGTTATGATGTCATTTCTCGAGAAATGACATCATAACCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080447
TTLL8 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080447.1-258s21c1
Sequence:CCGGCGTGATGTCTAGGTTGGTAAACTCGAGTTTACCAACCTAGACATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080447.1-2108s21c1
Sequence:CCGGGGGATCCAAACCAGCTAAATGCTCGAGCATTTAGCTGGTTTGGATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080447.1-981s21c1
Sequence:CCGGCCGGAACATCTGGATTATAAACTCGAGTTTATAATCCAGATGTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080447.1-1559s21c1
Sequence:CCGGCCTGGCTGATCGAGATCAATTCTCGAGAATTGATCTCGATCAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080447.1-874s21c1
Sequence:CCGGCAGAAGGTTATGATGTCATTTCTCGAGAAATGACATCATAACCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080447
TTLL8 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080447.1-258s21c1
Sequence:CCGGCGTGATGTCTAGGTTGGTAAACTCGAGTTTACCAACCTAGACATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080447.1-2108s21c1
Sequence:CCGGGGGATCCAAACCAGCTAAATGCTCGAGCATTTAGCTGGTTTGGATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080447.1-981s21c1
Sequence:CCGGCCGGAACATCTGGATTATAAACTCGAGTTTATAATCCAGATGTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080447.1-1559s21c1
Sequence:CCGGCCTGGCTGATCGAGATCAATTCTCGAGAATTGATCTCGATCAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080447.1-874s21c1
Sequence:CCGGCAGAAGGTTATGATGTCATTTCTCGAGAAATGACATCATAACCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172818
TTLL8 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 8
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172818.1-2721s1c1
Sequence:CCGGGCCTTTCTGTCCCATTGTATTCTCGAGAATACAATGGGACAGAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172818.2-1856s21c1
Sequence:CCGGTCCGCTGCTACCTTGTCATAACTCGAGTTATGACAAGGTAGCAGCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172818.2-942s21c1
Sequence:CCGGTACGGGAAGACAGCATCATTCCTCGAGGAATGATGCTGTCTTCCCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172818.2-2773s21c1
Sequence:CCGGGACGACCTTCAAGCTGTATTCCTCGAGGAATACAGCTTGAAGGTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172818.1-2573s1c1
Sequence:CCGGGCGGTTATACCAGAGTCCAATCTCGAGATTGGACTCTGGTATAACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172818.1-2530s1c1
Sequence:CCGGGAGGTCAATGACTACCAACATCTCGAGATGTTGGTAGTCATTGACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172818.1-822s1c1
Sequence:CCGGCGATGATATCCACGATGTGATCTCGAGATCACATCGTGGATATCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172818.1-1722s1c1
Sequence:CCGGCCTAACCATCTGGTTCTACAACTCGAGTTGTAGAACCAGATGGTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172818.2-1609s21c1
Sequence:CCGGAGACCACAAAGGACAACAAATCTCGAGATTTGTTGTCCTTTGTGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172818
TTLL8 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 8
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172818.1-2721s1c1
Sequence:CCGGGCCTTTCTGTCCCATTGTATTCTCGAGAATACAATGGGACAGAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172818.2-1856s21c1
Sequence:CCGGTCCGCTGCTACCTTGTCATAACTCGAGTTATGACAAGGTAGCAGCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172818.2-942s21c1
Sequence:CCGGTACGGGAAGACAGCATCATTCCTCGAGGAATGATGCTGTCTTCCCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172818.2-2773s21c1
Sequence:CCGGGACGACCTTCAAGCTGTATTCCTCGAGGAATACAGCTTGAAGGTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172818.1-2573s1c1
Sequence:CCGGGCGGTTATACCAGAGTCCAATCTCGAGATTGGACTCTGGTATAACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172818.1-2530s1c1
Sequence:CCGGGAGGTCAATGACTACCAACATCTCGAGATGTTGGTAGTCATTGACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172818.1-822s1c1
Sequence:CCGGCGATGATATCCACGATGTGATCTCGAGATCACATCGTGGATATCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172818.1-1722s1c1
Sequence:CCGGCCTAACCATCTGGTTCTACAACTCGAGTTGTAGAACCAGATGGTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172818.2-1609s21c1
Sequence:CCGGAGACCACAAAGGACAACAAATCTCGAGATTTGTTGTCCTTTGTGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172818
TTLL8 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 8
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172818.1-2721s1c1
Sequence:CCGGGCCTTTCTGTCCCATTGTATTCTCGAGAATACAATGGGACAGAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172818.2-1856s21c1
Sequence:CCGGTCCGCTGCTACCTTGTCATAACTCGAGTTATGACAAGGTAGCAGCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172818.2-942s21c1
Sequence:CCGGTACGGGAAGACAGCATCATTCCTCGAGGAATGATGCTGTCTTCCCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172818.2-2773s21c1
Sequence:CCGGGACGACCTTCAAGCTGTATTCCTCGAGGAATACAGCTTGAAGGTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172818.1-2573s1c1
Sequence:CCGGGCGGTTATACCAGAGTCCAATCTCGAGATTGGACTCTGGTATAACCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172818.1-2530s1c1
Sequence:CCGGGAGGTCAATGACTACCAACATCTCGAGATGTTGGTAGTCATTGACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172818.1-822s1c1
Sequence:CCGGCGATGATATCCACGATGTGATCTCGAGATCACATCGTGGATATCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172818.1-1722s1c1
Sequence:CCGGCCTAACCATCTGGTTCTACAACTCGAGTTGTAGAACCAGATGGTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172818.2-1609s21c1
Sequence:CCGGAGACCACAAAGGACAACAAATCTCGAGATTTGTTGTCCTTTGTGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)