EMAIL THIS PAGE TO A FRIEND

TUBA3C

tubulin, alpha 3c

9 Gene Product Result for
Synonyms: TUBA2 bA408E5.3
UniProtKB ID: Q13748, A6NJQ0, Q5W099, Q6PEY3, Q96F18
Gene ID:
Human(7278) Summary: Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulin. The genes encoding these microtubule constituents are part of the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes and they are highly conserved among and between species. This gene is an alpha tubulin gene that encodes a protein 99% identical to the mouse testis-specific Tuba3 and Tuba7 gene products. This gene is located in the 13q11 region, which is associated with the genetic diseases Clouston hidrotic ectodermal dysplasia and Kabuki syndrome. [provided by RefSeq, Jul 2008]
dog(610636) tubulin, alpha 3c
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006001 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006001 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006001 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006001 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340706 predicted 901
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006001
VALIDATED
TUBA3C MISSION shRNA Bacterial Glycerol Stock
tubulin, alpha 3c
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006001.1-1064s1c1
Sequence:CCGGCGCACCATCCAGTTTGTAGATCTCGAGATCTACAAACTGGATGGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006001.1-1328s1c1
Sequence:CCGGGCTCTGGAGAAGGATTATGAACTCGAGTTCATAATCCTTCTCCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006001.1-868s1c1
Sequence:CCGGCCCGGTCATCTCAGCCGAGAACTCGAGTTCTCGGCTGAGATGACCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006001.1-543s1c1
Sequence:CCGGCCAAGCTAGAATTTGCCATTTCTCGAGAAATGGCAAATTCTAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_006001.1-280s21c1
Sequence:CCGGAGTGCGCACAGGAACCTATAGCTCGAGCTATAGGTTCCTGTGCGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006001.1-1227s21c1
Sequence:CCGGATAAGTTCGATCTCATGTATGCTCGAGCATACATGAGATCGAACTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006001.1-187s1c1
Sequence:CCGGCGACTCCTTCAACACGTTCTTCTCGAGAAGAACGTGTTGAAGGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006001.1-666s21c1
Sequence:CCGGATGAAGCCATCTATGACATATCTCGAGATATGTCATAGATGGCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_006001.1-334s21c1
Sequence:CCGGGAAGGAAGATGCGGCCAATAACTCGAGTTATTGGCCGCATCTTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006001.1-1012s21c1
Sequence:CCGGGGATGTGGTCCCGAAAGATGTCTCGAGACATCTTTCGGGACCACATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006001
VALIDATED
TUBA3C MISSION shRNA shRNA Plasmid DNA
tubulin, alpha 3c
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006001.1-1064s1c1
Sequence:CCGGCGCACCATCCAGTTTGTAGATCTCGAGATCTACAAACTGGATGGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006001.1-1328s1c1
Sequence:CCGGGCTCTGGAGAAGGATTATGAACTCGAGTTCATAATCCTTCTCCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006001.1-868s1c1
Sequence:CCGGCCCGGTCATCTCAGCCGAGAACTCGAGTTCTCGGCTGAGATGACCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006001.1-543s1c1
Sequence:CCGGCCAAGCTAGAATTTGCCATTTCTCGAGAAATGGCAAATTCTAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_006001.1-280s21c1
Sequence:CCGGAGTGCGCACAGGAACCTATAGCTCGAGCTATAGGTTCCTGTGCGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006001.1-1227s21c1
Sequence:CCGGATAAGTTCGATCTCATGTATGCTCGAGCATACATGAGATCGAACTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006001.1-187s1c1
Sequence:CCGGCGACTCCTTCAACACGTTCTTCTCGAGAAGAACGTGTTGAAGGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006001.1-666s21c1
Sequence:CCGGATGAAGCCATCTATGACATATCTCGAGATATGTCATAGATGGCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_006001.1-334s21c1
Sequence:CCGGGAAGGAAGATGCGGCCAATAACTCGAGTTATTGGCCGCATCTTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006001.1-1012s21c1
Sequence:CCGGGGATGTGGTCCCGAAAGATGTCTCGAGACATCTTTCGGGACCACATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006001
VALIDATED
TUBA3C MISSION shRNA Lentiviral Transduction Particles
tubulin, alpha 3c
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006001.1-1064s1c1
Sequence:CCGGCGCACCATCCAGTTTGTAGATCTCGAGATCTACAAACTGGATGGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006001.1-1328s1c1
Sequence:CCGGGCTCTGGAGAAGGATTATGAACTCGAGTTCATAATCCTTCTCCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006001.1-868s1c1
Sequence:CCGGCCCGGTCATCTCAGCCGAGAACTCGAGTTCTCGGCTGAGATGACCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006001.1-543s1c1
Sequence:CCGGCCAAGCTAGAATTTGCCATTTCTCGAGAAATGGCAAATTCTAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_006001.1-280s21c1
Sequence:CCGGAGTGCGCACAGGAACCTATAGCTCGAGCTATAGGTTCCTGTGCGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006001.1-1227s21c1
Sequence:CCGGATAAGTTCGATCTCATGTATGCTCGAGCATACATGAGATCGAACTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006001.1-187s1c1
Sequence:CCGGCGACTCCTTCAACACGTTCTTCTCGAGAAGAACGTGTTGAAGGAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006001.1-666s21c1
Sequence:CCGGATGAAGCCATCTATGACATATCTCGAGATATGTCATAGATGGCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_006001.1-334s21c1
Sequence:CCGGGAAGGAAGATGCGGCCAATAACTCGAGTTATTGGCCGCATCTTCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006001.1-1012s21c1
Sequence:CCGGGGATGTGGTCCCGAAAGATGTCTCGAGACATCTTTCGGGACCACATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)