EMAIL THIS PAGE TO A FRIEND

TUBA3E

tubulin, alpha 3e

44 Gene Product Result for
UniProtKB ID: Q6PEY2
Gene ID:
chicken(421169) tubulin, alpha 3e
cow(100295712) tubulin, alpha 3e
cow(534900) tubulin, alpha 3e
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
Y0001466 Anhydrous Docetaxel European Pharmacopoeia (EP) Reference Standard human pricing
PHR1764 Colchicine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
C2580000 Colchicine (European Pharmacopoeia (EP) Reference Standard) human pricing
1146006 Colchicine United States Pharmacopeia (USP) Reference Standard human pricing
PHL89610 Colchicine phyproof® Reference Substance human pricing
BP1150 Colchicine British Pharmacopoeia (BP) Reference Standard human pricing
27650 Colchicine ≥96.0% (HPLC) human pricing
Y0000209 Colchicine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
Y0001958 Colchicine for system suitability A European Pharmacopoeia (EP) Reference Standard human pricing
01885 Docetaxel purum, ≥97.0% (HPLC) human pricing
SML1131 Fosbretabulin disodium ≥98% (HPLC) human pricing
T7402 Paclitaxel from Taxus brevifolia, ≥95% (HPLC), powder human pricing
T7191 Paclitaxel from semisynthetic, ≥97% human pricing
1491332 Paclitaxel United States Pharmacopeia (USP) Reference Standard human pricing
T1912 Paclitaxel from Taxus yannanensis, powder human pricing
Y0000698 Paclitaxel European Pharmacopoeia (EP) Reference Standard human pricing
PHR1803 Paclitaxel Pharmaceutical Secondary Standard; Certified Reference Material human pricing
417017 Paclitaxel From Taxus brevifolia, 95% human pricing
Y0000700 Paclitaxel natural for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0000719 Paclitaxel semi-synthetic for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0000739 Paclitaxel semi-synthetic for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHL89806 Taxol phyproof® Reference Substance human pricing
1713004 Vinblastine sulfate United States Pharmacopeia (USP) Reference Standard human pricing
V0300000 Vinblastine sulfate European Pharmacopoeia (EP) Reference Standard human pricing
V1377 Vinblastine sulfate salt ≥97% (HPLC) human pricing
C3915 Colchicine BioReagent, suitable for plant cell culture, ≥95% (HPLC) human, mouse pricing
C9754 Colchicine ≥95% (HPLC), powder human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_053177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_053177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_053177 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207312 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373844 predicted 948
2 SASI_Hs01_00114292 predicted 1107
3 SASI_Hs01_00114293 predicted 388
4 SASI_Hs01_00114294 predicted 749
5 SASI_Hs01_00114296 predicted 1108
6 SASI_Hs01_00114297 predicted 1377
7 SASI_Hs01_00114298 predicted 388
8 SASI_Hs01_00114295 predicted 1480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_053177
TUBA3E MISSION shRNA Bacterial Glycerol Stock
tubulin, alpha 3e
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000117167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1116s1c1
Sequence:CCGGCGCACTATCCAGTTTGTGGATCTCGAGATCCACAAACTGGATAGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1380s1c1
Sequence:CCGGGCTCTAGAGAAGGATTGTGAACTCGAGTTCACAATCCTTCTCTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1278s1c1
Sequence:CCGGCATAAGTTCGATCTCATGTATCTCGAGATACATGAGATCGAACTTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1147s1c1
Sequence:CCGGCTGGATTTAAGGTGGGCATTACTCGAGTAATGCCCACCTTAAATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_053177
TUBA3E MISSION shRNA shRNA Plasmid DNA
tubulin, alpha 3e
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000117167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1116s1c1
Sequence:CCGGCGCACTATCCAGTTTGTGGATCTCGAGATCCACAAACTGGATAGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1380s1c1
Sequence:CCGGGCTCTAGAGAAGGATTGTGAACTCGAGTTCACAATCCTTCTCTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1278s1c1
Sequence:CCGGCATAAGTTCGATCTCATGTATCTCGAGATACATGAGATCGAACTTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1147s1c1
Sequence:CCGGCTGGATTTAAGGTGGGCATTACTCGAGTAATGCCCACCTTAAATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_053177
TUBA3E MISSION shRNA Lentiviral Transduction Particles
tubulin, alpha 3e
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000117167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1116s1c1
Sequence:CCGGCGCACTATCCAGTTTGTGGATCTCGAGATCCACAAACTGGATAGTGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000117170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1380s1c1
Sequence:CCGGGCTCTAGAGAAGGATTGTGAACTCGAGTTCACAATCCTTCTCTAGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000117171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1278s1c1
Sequence:CCGGCATAAGTTCGATCTCATGTATCTCGAGATACATGAGATCGAACTTATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000117168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1147s1c1
Sequence:CCGGCTGGATTTAAGGTGGGCATTACTCGAGTAATGCCCACCTTAAATCCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???