EMAIL THIS PAGE TO A FRIEND

TUBB4A

tubulin, beta 4A class IVa

70 Gene Product Result for
Synonyms: DYT4 HLD6 TUBB4 TUBB5 beta-5
UniProtKB ID: P04350, B3KQP4, Q969E5
Gene ID:
Mouse(22153) tubulin, beta 4A class IVA
Rat(29213) tubulin, beta 4A class IVa
naked mole-rat(101724524) tubulin, beta 4A class IVa
domestic guinea pig(100720651) tubulin, beta 4A class IVa
cow(540236) tubulin, beta 4A class IVa
dog(476730) tubulin, beta 4A class IVa
domestic cat(101086953) tubulin, beta 4A class IVa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1104795 Anti-TUBB4 (154-164) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
T7816 Monoclonal Anti-β-Tubulin I antibody produced in mouse clone SAP.4G5, ascites fluid canine, bovine, human, hamster, chicken, Xenopus, rat, mouse
ELISA, immunocytochemistry, immunohistochemistry, microarray, western blot pricing
T7941 Monoclonal Anti-β-Tubulin IV antibody produced in mouse clone ONS.1A6, ascites fluid rat, human, hamster, chicken, mouse, bovine
ELISA, immunohistochemistry, microarray, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
Y0001466 Anhydrous Docetaxel European Pharmacopoeia (EP) Reference Standard human pricing
PHR1764 Colchicine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
C2580000 Colchicine (European Pharmacopoeia (EP) Reference Standard) human pricing
1146006 Colchicine United States Pharmacopeia (USP) Reference Standard human pricing
PHL89610 Colchicine phyproof® Reference Substance human pricing
BP1150 Colchicine British Pharmacopoeia (BP) Reference Standard human pricing
27650 Colchicine ≥96.0% (HPLC) human pricing
Y0000209 Colchicine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
Y0001958 Colchicine for system suitability A European Pharmacopoeia (EP) Reference Standard human pricing
01885 Docetaxel purum, ≥97.0% (HPLC) human pricing
SML1131 Fosbretabulin disodium ≥98% (HPLC) human pricing
T7402 Paclitaxel from Taxus brevifolia, ≥95% (HPLC), powder human pricing
T7191 Paclitaxel from semisynthetic, ≥97% human pricing
1491332 Paclitaxel United States Pharmacopeia (USP) Reference Standard human pricing
T1912 Paclitaxel from Taxus yannanensis, powder human pricing
Y0000698 Paclitaxel European Pharmacopoeia (EP) Reference Standard human pricing
PHR1803 Paclitaxel Pharmaceutical Secondary Standard; Certified Reference Material human pricing
417017 Paclitaxel From Taxus brevifolia, 95% human pricing
Y0000700 Paclitaxel natural for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0000719 Paclitaxel semi-synthetic for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0000739 Paclitaxel semi-synthetic for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHL89806 Taxol phyproof® Reference Substance human pricing
1713004 Vinblastine sulfate United States Pharmacopeia (USP) Reference Standard human pricing
V0300000 Vinblastine sulfate European Pharmacopoeia (EP) Reference Standard human pricing
V1377 Vinblastine sulfate salt ≥97% (HPLC) human pricing
C3915 Colchicine BioReagent, suitable for plant cell culture, ≥95% (HPLC) human, mouse pricing
C9754 Colchicine ≥95% (HPLC), powder human, mouse pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0078 AQUA Peptide FPGQLNADL[R] African clawed frog, cow, honey bee, human, mouse, rat pricing
AQ0079 AQUA Peptide YLTVAAVF[R] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, rat, sheep pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006087 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006087 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006087 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009451 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009451 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009451 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006087 Rosetta Predictions human pricing
NM_080882 Rosetta Predictions rat pricing
NM_009451 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125231 predicted 1714
2 SASI_Hs01_00125232 predicted 1694
3 SASI_Hs01_00125234 predicted 1800
4 SASI_Hs01_00125235 predicted 1700
5 SASI_Hs01_00125236 predicted 1717
6 SASI_Hs01_00125237 predicted 1794
7 SASI_Hs01_00125239 predicted 1746
8 SASI_Hs01_00125240 predicted 1703
9 SASI_Hs02_00340865 predicted 1643
10 SASI_Hs02_00340866 predicted 1086
11 SASI_Hs01_00125233 predicted 720
12 SASI_Hs01_00125238 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267316 predicted 1253
2 SASI_Rn02_00267317 predicted 1427
3 SASI_Rn02_00267318 predicted 1336
4 SASI_Rn02_00267319 predicted 663
5 SASI_Rn02_00267320 predicted 273
6 SASI_Rn02_00267321 predicted 348
7 SASI_Rn02_00267322 predicted 429
8 SASI_Rn02_00267323 predicted 592
9 SASI_Rn02_00267324 predicted 695
10 SASI_Rn02_00267325 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009451 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062575 predicted 431
2 SASI_Mm01_00062580 predicted 1494
3 SASI_Mm01_00062581 predicted 829
4 SASI_Mm01_00062576 predicted 742
5 SASI_Mm01_00062577 predicted 512
6 SASI_Mm01_00062583 predicted 824
7 SASI_Mm01_00062578 predicted 270
8 SASI_Mm01_00062579 predicted 1114
9 SASI_Mm01_00062582 predicted 407
10 SASI_Mm01_00062584 predicted 1666
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006087
TUBB4A MISSION shRNA Bacterial Glycerol Stock
tubulin, beta 4A class IVa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006087.2-373s21c1
Sequence:CCGGACTTCGTGTTTGGCCAATCCGCTCGAGCGGATTGGCCAAACACGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006087.2-1802s21c1
Sequence:CCGGGACCTATAAGTTCTGGTTTATCTCGAGATAAACCAGAACTTATAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006087.2-173s21c1
Sequence:CCGGGGTTATCAGTGACGAACATGGCTCGAGCCATGTTCGTCACTGATAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006087.2-1345s1c1
Sequence:CCGGGCAACATGAATGACCTGGTATCTCGAGATACCAGGTCATTCATGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006087.2-867s1c1
Sequence:CCGGGCCGTCAACATGGTTCCCTTTCTCGAGAAAGGGAACCATGTTGACGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006087.2-260s1c1
Sequence:CCGGCAACGAGGCCACAGGAGGAAACTCGAGTTTCCTCCTGTGGCCTCGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006087.2-477s1c1
Sequence:CCGGGCCGAGAGCTGCGACTGCCTTCTCGAGAAGGCAGTCGCAGCTCTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006087.2-227s1c1
Sequence:CCGGTGACCTGCAACTGGAGAGGATCTCGAGATCCTCTCCAGTTGCAGGTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006087
TUBB4A MISSION shRNA shRNA Plasmid DNA
tubulin, beta 4A class IVa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006087.2-373s21c1
Sequence:CCGGACTTCGTGTTTGGCCAATCCGCTCGAGCGGATTGGCCAAACACGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006087.2-1802s21c1
Sequence:CCGGGACCTATAAGTTCTGGTTTATCTCGAGATAAACCAGAACTTATAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006087.2-173s21c1
Sequence:CCGGGGTTATCAGTGACGAACATGGCTCGAGCCATGTTCGTCACTGATAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006087.2-1345s1c1
Sequence:CCGGGCAACATGAATGACCTGGTATCTCGAGATACCAGGTCATTCATGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006087.2-867s1c1
Sequence:CCGGGCCGTCAACATGGTTCCCTTTCTCGAGAAAGGGAACCATGTTGACGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006087.2-260s1c1
Sequence:CCGGCAACGAGGCCACAGGAGGAAACTCGAGTTTCCTCCTGTGGCCTCGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006087.2-477s1c1
Sequence:CCGGGCCGAGAGCTGCGACTGCCTTCTCGAGAAGGCAGTCGCAGCTCTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006087.2-227s1c1
Sequence:CCGGTGACCTGCAACTGGAGAGGATCTCGAGATCCTCTCCAGTTGCAGGTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006087
TUBB4A MISSION shRNA Lentiviral Transduction Particles
tubulin, beta 4A class IVa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006087.2-373s21c1
Sequence:CCGGACTTCGTGTTTGGCCAATCCGCTCGAGCGGATTGGCCAAACACGAAGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000413593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006087.2-1802s21c1
Sequence:CCGGGACCTATAAGTTCTGGTTTATCTCGAGATAAACCAGAACTTATAGGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000430961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006087.2-173s21c1
Sequence:CCGGGGTTATCAGTGACGAACATGGCTCGAGCCATGTTCGTCACTGATAACCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006087.2-1345s1c1
Sequence:CCGGGCAACATGAATGACCTGGTATCTCGAGATACCAGGTCATTCATGTTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006087.2-867s1c1
Sequence:CCGGGCCGTCAACATGGTTCCCTTTCTCGAGAAAGGGAACCATGTTGACGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006087.2-260s1c1
Sequence:CCGGCAACGAGGCCACAGGAGGAAACTCGAGTTTCCTCCTGTGGCCTCGTTGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006087.2-477s1c1
Sequence:CCGGGCCGAGAGCTGCGACTGCCTTCTCGAGAAGGCAGTCGCAGCTCTCGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006087.2-227s1c1
Sequence:CCGGTGACCTGCAACTGGAGAGGATCTCGAGATCCTCTCCAGTTGCAGGTCATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009451
TUBB4A MISSION shRNA Bacterial Glycerol Stock
tubulin, beta 4A class IVa
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009451.3-1902s21c1
Sequence:CCGGCAGCACTCCTGAACCATTCTCCTCGAGGAGAATGGTTCAGGAGTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009451.3-1746s1c1
Sequence:CCGGGCTTCACCTTTAACTCCTAAACTCGAGTTTAGGAGTTAAAGGTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009451.3-1490s1c1
Sequence:CCGGGTTTACGGAAGCAGAGAGCAACTCGAGTTGCTCTCTGCTTCCGTAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009451.3-429s1c1
Sequence:CCGGGCCACAGGTGGAAACTATGTTCTCGAGAACATAGTTTCCACCTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009451.3-531s1c1
Sequence:CCGGGACAACTTTGTATTTGGTCAACTCGAGTTGACCAAATACAAAGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009451.3-1058s1c1
Sequence:CCGGCCACTTCTTCATGCCAGGATTCTCGAGAATCCTGGCATGAAGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009451.3-1851s21c1
Sequence:CCGGTCCACCTTCTTAGATCTTGAACTCGAGTTCAAGATCTAAGAAGGTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009451
TUBB4A MISSION shRNA shRNA Plasmid DNA
tubulin, beta 4A class IVa
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009451.3-1902s21c1
Sequence:CCGGCAGCACTCCTGAACCATTCTCCTCGAGGAGAATGGTTCAGGAGTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009451.3-1746s1c1
Sequence:CCGGGCTTCACCTTTAACTCCTAAACTCGAGTTTAGGAGTTAAAGGTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009451.3-1490s1c1
Sequence:CCGGGTTTACGGAAGCAGAGAGCAACTCGAGTTGCTCTCTGCTTCCGTAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009451.3-429s1c1
Sequence:CCGGGCCACAGGTGGAAACTATGTTCTCGAGAACATAGTTTCCACCTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009451.3-531s1c1
Sequence:CCGGGACAACTTTGTATTTGGTCAACTCGAGTTGACCAAATACAAAGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009451.3-1058s1c1
Sequence:CCGGCCACTTCTTCATGCCAGGATTCTCGAGAATCCTGGCATGAAGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009451.3-1851s21c1
Sequence:CCGGTCCACCTTCTTAGATCTTGAACTCGAGTTCAAGATCTAAGAAGGTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009451
TUBB4A MISSION shRNA Lentiviral Transduction Particles
tubulin, beta 4A class IVa
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009451.3-1902s21c1
Sequence:CCGGCAGCACTCCTGAACCATTCTCCTCGAGGAGAATGGTTCAGGAGTGCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000089723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009451.3-1746s1c1
Sequence:CCGGGCTTCACCTTTAACTCCTAAACTCGAGTTTAGGAGTTAAAGGTGAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000089725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009451.3-1490s1c1
Sequence:CCGGGTTTACGGAAGCAGAGAGCAACTCGAGTTGCTCTCTGCTTCCGTAAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000089726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009451.3-429s1c1
Sequence:CCGGGCCACAGGTGGAAACTATGTTCTCGAGAACATAGTTTCCACCTGTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000089724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009451.3-531s1c1
Sequence:CCGGGACAACTTTGTATTTGGTCAACTCGAGTTGACCAAATACAAAGTTGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000089727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009451.3-1058s1c1
Sequence:CCGGCCACTTCTTCATGCCAGGATTCTCGAGAATCCTGGCATGAAGAAGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000420496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009451.3-1851s21c1
Sequence:CCGGTCCACCTTCTTAGATCTTGAACTCGAGTTCAAGATCTAAGAAGGTGGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???