EMAIL THIS PAGE TO A FRIEND

Tubb5

30 Gene Product Result for
Gene ID:
Rat(29214) tubulin, beta 5 class I
Zebrafish(386701) tubulin, beta 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0078 AQUA Peptide FPGQLNADL[R] African clawed frog, cow, honey bee, human, mouse, rat pricing
AQ0079 AQUA Peptide YLTVAAVF[R] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, rat, sheep pricing
AQ0828 AQUA Peptide EIVHIQAGQ(CAM)GNQIGA[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011655 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011655 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011655 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU024771 MISSION® esiRNA esiRNA targeting mouse Tubb5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173102 Rosetta Predictions rat pricing
NM_011655 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102055 predicted 341
2 SASI_Rn01_00102056 predicted 1508
3 SASI_Rn01_00102057 predicted 1511
4 SASI_Rn01_00102058 predicted 1742
5 SASI_Rn01_00102060 predicted 1755
6 SASI_Rn02_00269255 predicted 608
7 SASI_Rn01_00102062 predicted 1721
8 SASI_Rn01_00102064 predicted 1670
9 SASI_Rn02_00269256 predicted 1679
10 SASI_Rn02_00269257 predicted 396
11 SASI_Rn01_00102059 predicted 357
12 SASI_Rn01_00102061 predicted 1462
13 SASI_Rn01_00102063 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321150 predicted 908
2 SASI_Mm01_00040012 predicted 557
3 SASI_Mm01_00040013 predicted 358
4 SASI_Mm01_00040014 predicted 375
5 SASI_Mm01_00040015 predicted 657
6 SASI_Mm01_00040016 predicted 315
7 SASI_Mm01_00040017 predicted 323
8 SASI_Mm01_00040018 predicted 924
9 SASI_Mm01_00040019 predicted 349
10 SASI_Mm01_00040020 predicted 360
11 SASI_Mm01_00040011 predicted 485
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011655
VALIDATED
Tubb5 MISSION shRNA Bacterial Glycerol Stock
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011655.5-1609s21c1
Sequence:CCGGGCTGCTTAGATCCCTCAGCTTCTCGAGAAGCTGAGGGATCTAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011655.5-435s21c1
Sequence:CCGGGCTATCTTGGTGGATCTAGAACTCGAGTTCTAGATCCACCAAGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011655.5-1394s21c1
Sequence:CCGGTGAGCAGTTTACGGCTATGTTCTCGAGAACATAGCCGTAAACTGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011655.2-1515s1c1
Sequence:CCGGGCTGCTTAGATCCCTCAGCTTCTCGAGAAGCTGAGGGATCTAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011655.2-341s1c1
Sequence:CCGGGCTATCTTGGTGGATCTAGAACTCGAGTTCTAGATCCACCAAGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011655.2-290s1c1
Sequence:CCGGCGAATCTCTGTGTACTATAATCTCGAGATTATAGTACACAGAGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011655.2-287s1c1
Sequence:CCGGGACCGAATCTCTGTGTACTATCTCGAGATAGTACACAGAGATTCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011655.2-1300s1c1
Sequence:CCGGTGAGCAGTTTACGGCTATGTTCTCGAGAACATAGCCGTAAACTGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011655.5-381s21c1
Sequence:CCGGGACCGAATCTCTGTGTACTATCTCGAGATAGTACACAGAGATTCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011655
VALIDATED
Tubb5 MISSION shRNA shRNA Plasmid DNA
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011655.5-1609s21c1
Sequence:CCGGGCTGCTTAGATCCCTCAGCTTCTCGAGAAGCTGAGGGATCTAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011655.5-435s21c1
Sequence:CCGGGCTATCTTGGTGGATCTAGAACTCGAGTTCTAGATCCACCAAGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011655.5-1394s21c1
Sequence:CCGGTGAGCAGTTTACGGCTATGTTCTCGAGAACATAGCCGTAAACTGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011655.2-1515s1c1
Sequence:CCGGGCTGCTTAGATCCCTCAGCTTCTCGAGAAGCTGAGGGATCTAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011655.2-341s1c1
Sequence:CCGGGCTATCTTGGTGGATCTAGAACTCGAGTTCTAGATCCACCAAGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011655.2-290s1c1
Sequence:CCGGCGAATCTCTGTGTACTATAATCTCGAGATTATAGTACACAGAGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011655.2-287s1c1
Sequence:CCGGGACCGAATCTCTGTGTACTATCTCGAGATAGTACACAGAGATTCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011655.2-1300s1c1
Sequence:CCGGTGAGCAGTTTACGGCTATGTTCTCGAGAACATAGCCGTAAACTGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011655.5-381s21c1
Sequence:CCGGGACCGAATCTCTGTGTACTATCTCGAGATAGTACACAGAGATTCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011655
VALIDATED
Tubb5 MISSION shRNA Lentiviral Transduction Particles
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011655.5-1609s21c1
Sequence:CCGGGCTGCTTAGATCCCTCAGCTTCTCGAGAAGCTGAGGGATCTAAGCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000326578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011655.5-435s21c1
Sequence:CCGGGCTATCTTGGTGGATCTAGAACTCGAGTTCTAGATCCACCAAGATAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000326562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011655.5-1394s21c1
Sequence:CCGGTGAGCAGTTTACGGCTATGTTCTCGAGAACATAGCCGTAAACTGCTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000090068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011655.2-1515s1c1
Sequence:CCGGGCTGCTTAGATCCCTCAGCTTCTCGAGAAGCTGAGGGATCTAAGCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000090072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011655.2-341s1c1
Sequence:CCGGGCTATCTTGGTGGATCTAGAACTCGAGTTCTAGATCCACCAAGATAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000090069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011655.2-290s1c1
Sequence:CCGGCGAATCTCTGTGTACTATAATCTCGAGATTATAGTACACAGAGATTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000090070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011655.2-287s1c1
Sequence:CCGGGACCGAATCTCTGTGTACTATCTCGAGATAGTACACAGAGATTCGGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000090071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011655.2-1300s1c1
Sequence:CCGGTGAGCAGTTTACGGCTATGTTCTCGAGAACATAGCCGTAAACTGCTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000326568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011655.5-381s21c1
Sequence:CCGGGACCGAATCTCTGTGTACTATCTCGAGATAGTACACAGAGATTCGGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???