EMAIL THIS PAGE TO A FRIEND

TUBB8

tubulin, beta 8 class VIII

35 Gene Product Result for
Synonyms: bA631M21.2
Species: Human TUBB8(347688)
UniProtKB ID: Q3ZCM7, Q5SQX9, Q8WZ78
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2700070 Anti-TUBB8 (C-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
HPA043640 Anti-TUBB8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunohistochemistry, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
Y0001466 Anhydrous Docetaxel European Pharmacopoeia (EP) Reference Standard human pricing
PHR1764 Colchicine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
C2580000 Colchicine (European Pharmacopoeia (EP) Reference Standard) human pricing
1146006 Colchicine United States Pharmacopeia (USP) Reference Standard human pricing
PHL89610 Colchicine phyproof® Reference Substance human pricing
BP1150 Colchicine British Pharmacopoeia (BP) Reference Standard human pricing
27650 Colchicine ≥96.0% (HPLC) human pricing
Y0000209 Colchicine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
Y0001958 Colchicine for system suitability A European Pharmacopoeia (EP) Reference Standard human pricing
01885 Docetaxel purum, ≥97.0% (HPLC) human pricing
SML1131 Fosbretabulin disodium ≥98% (HPLC) human pricing
T7402 Paclitaxel from Taxus brevifolia, ≥95% (HPLC), powder human pricing
T7191 Paclitaxel from semisynthetic, ≥97% human pricing
1491332 Paclitaxel United States Pharmacopeia (USP) Reference Standard human pricing
T1912 Paclitaxel from Taxus yannanensis, powder human pricing
Y0000698 Paclitaxel European Pharmacopoeia (EP) Reference Standard human pricing
PHR1803 Paclitaxel Pharmaceutical Secondary Standard; Certified Reference Material human pricing
417017 Paclitaxel From Taxus brevifolia, 95% human pricing
Y0000700 Paclitaxel natural for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0000719 Paclitaxel semi-synthetic for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0000739 Paclitaxel semi-synthetic for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHL89806 Taxol phyproof® Reference Substance human pricing
1713004 Vinblastine sulfate United States Pharmacopeia (USP) Reference Standard human pricing
V0300000 Vinblastine sulfate European Pharmacopoeia (EP) Reference Standard human pricing
V1377 Vinblastine sulfate salt ≥97% (HPLC) human pricing
C3915 Colchicine BioReagent, suitable for plant cell culture, ≥95% (HPLC) human, mouse pricing
C9754 Colchicine ≥95% (HPLC), powder human, mouse pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0078 AQUA Peptide FPGQLNADL[R] African clawed frog, cow, honey bee, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177987 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177987 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177987 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177987 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177987 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234325 predicted 610
2 SASI_Hs01_00234326 predicted 433
3 SASI_Hs01_00234327 predicted 606
4 SASI_Hs01_00234328 predicted 609
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177987
TUBB8 MISSION shRNA Bacterial Glycerol Stock
tubulin, beta 8 class VIII
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-760s1c1
Sequence:CCGGGCCGTGAACATGGTCCCGTTTCTCGAGAAACGGGACCATGTTCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-1093s1c1
Sequence:CCGGGCCACCTTCATTGGGAATAATCTCGAGATTATTCCCAATGAAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-443s1c1
Sequence:CCGGGTACCCTTCTGCTCAGTAAGACTCGAGTCTTACTGAGCAGAAGGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-1004s21c1
Sequence:CCGGATAAGAACAGCAGTTACTTTGCTCGAGCAAAGTAACTGCTGTTCTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-869s1c1
Sequence:CCGGCCCAGCAGATGTTTGATGCTACTCGAGTAGCATCAAACATCTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-870s1c1
Sequence:CCGGCCAGCAGATGTTTGATGCTAACTCGAGTTAGCATCAAACATCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-133s21c1
Sequence:CCGGGAGCGCATCAACGTGTACTACCTCGAGGTAGTACACGTTGATGCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-1136s21c1
Sequence:CCGGAGCGTGTCTCAGAGCAGTTTACTCGAGTAAACTGCTCTGAGACACGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-611s21c1
Sequence:CCGGACGAAGCTCTGTATGACATATCTCGAGATATGTCATACAGAGCTTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177987
TUBB8 MISSION shRNA shRNA Plasmid DNA
tubulin, beta 8 class VIII
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-760s1c1
Sequence:CCGGGCCGTGAACATGGTCCCGTTTCTCGAGAAACGGGACCATGTTCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-1093s1c1
Sequence:CCGGGCCACCTTCATTGGGAATAATCTCGAGATTATTCCCAATGAAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-443s1c1
Sequence:CCGGGTACCCTTCTGCTCAGTAAGACTCGAGTCTTACTGAGCAGAAGGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-1004s21c1
Sequence:CCGGATAAGAACAGCAGTTACTTTGCTCGAGCAAAGTAACTGCTGTTCTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-869s1c1
Sequence:CCGGCCCAGCAGATGTTTGATGCTACTCGAGTAGCATCAAACATCTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-870s1c1
Sequence:CCGGCCAGCAGATGTTTGATGCTAACTCGAGTTAGCATCAAACATCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-133s21c1
Sequence:CCGGGAGCGCATCAACGTGTACTACCTCGAGGTAGTACACGTTGATGCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-1136s21c1
Sequence:CCGGAGCGTGTCTCAGAGCAGTTTACTCGAGTAAACTGCTCTGAGACACGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-611s21c1
Sequence:CCGGACGAAGCTCTGTATGACATATCTCGAGATATGTCATACAGAGCTTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177987
TUBB8 MISSION shRNA Lentiviral Transduction Particles
tubulin, beta 8 class VIII
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-760s1c1
Sequence:CCGGGCCGTGAACATGGTCCCGTTTCTCGAGAAACGGGACCATGTTCACGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000116637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-1093s1c1
Sequence:CCGGGCCACCTTCATTGGGAATAATCTCGAGATTATTCCCAATGAAGGTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000116639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-443s1c1
Sequence:CCGGGTACCCTTCTGCTCAGTAAGACTCGAGTCTTACTGAGCAGAAGGGTACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000412517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-1004s21c1
Sequence:CCGGATAAGAACAGCAGTTACTTTGCTCGAGCAAAGTAACTGCTGTTCTTATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000116640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-869s1c1
Sequence:CCGGCCCAGCAGATGTTTGATGCTACTCGAGTAGCATCAAACATCTGCTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000116638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-870s1c1
Sequence:CCGGCCAGCAGATGTTTGATGCTAACTCGAGTTAGCATCAAACATCTGCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000436942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-133s21c1
Sequence:CCGGGAGCGCATCAACGTGTACTACCTCGAGGTAGTACACGTTGATGCGCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000421407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-1136s21c1
Sequence:CCGGAGCGTGTCTCAGAGCAGTTTACTCGAGTAAACTGCTCTGAGACACGCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000422246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-611s21c1
Sequence:CCGGACGAAGCTCTGTATGACATATCTCGAGATATGTCATACAGAGCTTCGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???