EMAIL THIS PAGE TO A FRIEND

UBC

ubiquitin C

51 Gene Product Result for
Synonyms: HMG20
Gene ID:
Human(7316) Summary: This gene represents a ubiquitin gene, ubiquitin C. The encoded protein is a polyubiquitin precursor. Conjugation of ubiquitin monomers or polymers can lead to various effects within a cell, depending on the residues to which ubiquitin is conjugated. Ubiquitination has been associated with protein degradation, DNA repair, cell cycle regulation, kinase modification, endocytosis, and regulation of other cell signaling pathways. [provided by RefSeq, Aug 2010]
Mouse(22190) ubiquitin C
Rat(50522) ubiquitin C
Zebrafish(777766) ubiquitin C
Horse(100033924) ubiquitin C
Horse(100059289) ubiquitin C
dog(610457) ubiquitin C
chicken(396425) ubiquitin C
cow(444874) ubiquitin C
sheep(443016) ubiquitin C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5700792 Anti-UBC antibody produced in rabbit human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
HPA041344 Anti-UBC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
U5379 Anti-Ubiquitin antibody produced in rabbit whole antiserum, lyophilized powder eukaryotes, prokaryotes
immunohistochemistry, western blot pricing
U0508 Monoclonal Anti-Ubiquitin antibody produced in mouse clone 6C1, ascites fluid bovine, mouse, rat, human
ELISA, microarray, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0685 AQUA Peptide ESTLHLVL[R] human, mouse, rat pricing
AQ0888 AQUA Peptide TLSDYNIQ[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019639 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019639 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019639 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021009 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021009 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021009 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021009 Rosetta Predictions human pricing
NM_017314 Rosetta Predictions rat pricing
XM_001073679 Rosetta Predictions rat pricing
XM_001073717 Rosetta Predictions rat pricing
NM_019639 Rosetta Predictions mouse pricing
XM_001471699 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354481 predicted 1704
2 SASI_Hs02_00354482 predicted 1008
3 SASI_Hs01_00040055 predicted 1481
4 SASI_Hs01_00040056 predicted 2281
5 SASI_Hs01_00040057 predicted 1446
6 SASI_Hs01_00040058 predicted 1775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017314 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112152 predicted 376
2 SASI_Rn01_00112153 predicted 2406
3 SASI_Rn01_00112154 predicted 2509
4 SASI_Rn01_00112155 predicted 2387
5 SASI_Rn01_00112159 predicted 49
6 SASI_Rn01_00112156 predicted 2391
7 SASI_Rn01_00112157 predicted 48
8 SASI_Rn01_00112158 predicted 2499
9 SASI_Rn01_00112160 predicted 2368
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073679 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343515 predicted 395
2 SASI_Rn02_00343516 predicted 213
3 SASI_Rn02_00343517 predicted 215
4 SASI_Rn02_00343518 predicted 805
5 SASI_Rn02_00343519 predicted 963
6 SASI_Rn02_00343520 predicted 815
7 SASI_Rn02_00343521 predicted 844
8 SASI_Rn02_00343522 predicted 106
9 SASI_Rn02_00343523 predicted 859
10 SASI_Rn02_00343524 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073717 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343657 predicted 273
2 SASI_Rn02_00343658 predicted 329
3 SASI_Rn02_00343659 predicted 262
4 SASI_Rn02_00343660 predicted 372
5 SASI_Rn02_00343661 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019639 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324674 predicted 991
2 SASI_Mm02_00324675 predicted 994
3 SASI_Mm01_00090987 predicted 395
4 SASI_Mm01_00090986 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001471699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00357409 predicted 1375
2 SASI_Mm02_00357410 predicted 1374
3 SASI_Mm02_00357411 predicted 783
4 SASI_Mm02_00357412 predicted 1237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019639
VALIDATED
UBC MISSION shRNA Bacterial Glycerol Stock
ubiquitin C
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019639.2-1661s1c1
Sequence:CCGGCCATAGAGAATGTCAAGGCAACTCGAGTTGCCTTGACATTCTCTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019639.2-1200s1c1
Sequence:CCGGTGACACCATAGAGAATGTCAACTCGAGTTGACATTCTCTATGGTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019639.2-2449s1c1
Sequence:CCGGTCAGACTACAACATCCAGAAACTCGAGTTTCTGGATGTTGTAGTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019639.2-621s1c1
Sequence:CCGGCCTGTCAGACTACAACATCCACTCGAGTGGATGTTGTAGTCTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019639.2-521s1c1
Sequence:CCGGCCATTGAGAATGTCAAGGCAACTCGAGTTGCCTTGACATTCTCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019639.4-276s21c1
Sequence:CCGGCCTGTCAGACTACAACATCCACTCGAGTGGATGTTGTAGTCTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019639.4-997s21c1
Sequence:CCGGCACTTAGTCCTTCGCCTCAGACTCGAGTCTGAGGCGAAGGACTAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019639.4-399s21c1
Sequence:CCGGTGACACCATAGAGAATGTCAACTCGAGTTGACATTCTCTATGGTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019639.4-2225s21c1
Sequence:CCGGTTACCACCAAGAAGGTCAAACCTCGAGGTTTGACCTTCTTGGTGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019639.4-2254s21c1
Sequence:CCGGAGACGTACCTTCCTCACCACACTCGAGTGTGGTGAGGAAGGTACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019639.4-2237s21c1
Sequence:CCGGAGGTCAAACAGGAAGACAGACCTCGAGGTCTGTCTTCCTGTTTGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019639
VALIDATED
UBC MISSION shRNA shRNA Plasmid DNA
ubiquitin C
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019639.2-1661s1c1
Sequence:CCGGCCATAGAGAATGTCAAGGCAACTCGAGTTGCCTTGACATTCTCTATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000098658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019639.2-1200s1c1
Sequence:CCGGTGACACCATAGAGAATGTCAACTCGAGTTGACATTCTCTATGGTGTCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000098659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019639.2-2449s1c1
Sequence:CCGGTCAGACTACAACATCCAGAAACTCGAGTTTCTGGATGTTGTAGTCTGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000098657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019639.2-621s1c1
Sequence:CCGGCCTGTCAGACTACAACATCCACTCGAGTGGATGTTGTAGTCTGACAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000098656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019639.2-521s1c1
Sequence:CCGGCCATTGAGAATGTCAAGGCAACTCGAGTTGCCTTGACATTCTCAATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000316517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019639.4-276s21c1
Sequence:CCGGCCTGTCAGACTACAACATCCACTCGAGTGGATGTTGTAGTCTGACAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000374489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019639.4-997s21c1
Sequence:CCGGCACTTAGTCCTTCGCCTCAGACTCGAGTCTGAGGCGAAGGACTAAGTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000316601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019639.4-399s21c1
Sequence:CCGGTGACACCATAGAGAATGTCAACTCGAGTTGACATTCTCTATGGTGTCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000304872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019639.4-2225s21c1
Sequence:CCGGTTACCACCAAGAAGGTCAAACCTCGAGGTTTGACCTTCTTGGTGGTAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000311144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019639.4-2254s21c1
Sequence:CCGGAGACGTACCTTCCTCACCACACTCGAGTGTGGTGAGGAAGGTACGTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000374421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019639.4-2237s21c1
Sequence:CCGGAGGTCAAACAGGAAGACAGACCTCGAGGTCTGTCTTCCTGTTTGACCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019639
VALIDATED
UBC MISSION shRNA Lentiviral Transduction Particles
ubiquitin C
Mouse
11 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000098655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019639.2-1661s1c1
Sequence:CCGGCCATAGAGAATGTCAAGGCAACTCGAGTTGCCTTGACATTCTCTATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019639.2-1200s1c1
Sequence:CCGGTGACACCATAGAGAATGTCAACTCGAGTTGACATTCTCTATGGTGTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019639.2-2449s1c1
Sequence:CCGGTCAGACTACAACATCCAGAAACTCGAGTTTCTGGATGTTGTAGTCTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019639.2-621s1c1
Sequence:CCGGCCTGTCAGACTACAACATCCACTCGAGTGGATGTTGTAGTCTGACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019639.2-521s1c1
Sequence:CCGGCCATTGAGAATGTCAAGGCAACTCGAGTTGCCTTGACATTCTCAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019639.4-276s21c1
Sequence:CCGGCCTGTCAGACTACAACATCCACTCGAGTGGATGTTGTAGTCTGACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019639.4-997s21c1
Sequence:CCGGCACTTAGTCCTTCGCCTCAGACTCGAGTCTGAGGCGAAGGACTAAGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019639.4-399s21c1
Sequence:CCGGTGACACCATAGAGAATGTCAACTCGAGTTGACATTCTCTATGGTGTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019639.4-2225s21c1
Sequence:CCGGTTACCACCAAGAAGGTCAAACCTCGAGGTTTGACCTTCTTGGTGGTAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019639.4-2254s21c1
Sequence:CCGGAGACGTACCTTCCTCACCACACTCGAGTGTGGTGAGGAAGGTACGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019639.4-2237s21c1
Sequence:CCGGAGGTCAAACAGGAAGACAGACCTCGAGGTCTGTCTTCCTGTTTGACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021009
VALIDATED
UBC MISSION shRNA Bacterial Glycerol Stock
ubiquitin C
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021009.2-419s1c1
Sequence:CCGGGAGGTTGATCTTTGCCGGAAACTCGAGTTTCCGGCAAAGATCAACCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021009.2-1518s1c1
Sequence:CCGGGCAAAGATCCAAGACAAGGAACTCGAGTTCCTTGTCTTGGATCTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021009.2-821s1c1
Sequence:CCGGCGAGAACGTCAAAGCAAAGATCTCGAGATCTTTGCTTTGACGTTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021009.2-1961s1c1
Sequence:CCGGCGAGAATGTCAAGGCAAAGATCTCGAGATCTTTGCCTTGACATTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021009.2-2016s1c1
Sequence:CCGGAGGTTGATCTTTGCTGGGAAACTCGAGTTTCCCAGCAAAGATCAACCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021009.4-1747s21c1
Sequence:CCGGACGCACCCTGTCTGACTACAACTCGAGTTGTAGTCAGACAGGGTGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021009.4-901s21c1
Sequence:CCGGTGGGATGCAGATCTTCGTGAACTCGAGTTCACGAAGATCTGCATCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021009.4-1414s21c1
Sequence:CCGGGCCGAGTGACACCATTGAGAACTCGAGTTCTCAATGGTGTCACTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021009.4-2287s21c1
Sequence:CCGGGAAGACCCTGACTGGTAAGACCTCGAGGTCTTACCAGTCAGGGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021009.4-1064s21c1
Sequence:CCGGCGTACCCTGTCTGACTACAACCTCGAGGTTGTAGTCAGACAGGGTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021009.4-665s21c1
Sequence:CCGGCTCAGAGGTGGGATGCAAATCCTCGAGGATTTGCATCCCACCTCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021009
VALIDATED
UBC MISSION shRNA shRNA Plasmid DNA
ubiquitin C
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021009.2-419s1c1
Sequence:CCGGGAGGTTGATCTTTGCCGGAAACTCGAGTTTCCGGCAAAGATCAACCTCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000011108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021009.2-1518s1c1
Sequence:CCGGGCAAAGATCCAAGACAAGGAACTCGAGTTCCTTGTCTTGGATCTTTGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000011109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021009.2-821s1c1
Sequence:CCGGCGAGAACGTCAAAGCAAAGATCTCGAGATCTTTGCTTTGACGTTCTCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000011107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021009.2-1961s1c1
Sequence:CCGGCGAGAATGTCAAGGCAAAGATCTCGAGATCTTTGCCTTGACATTCTCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000011110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021009.2-2016s1c1
Sequence:CCGGAGGTTGATCTTTGCTGGGAAACTCGAGTTTCCCAGCAAAGATCAACCTTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000426019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021009.4-1747s21c1
Sequence:CCGGACGCACCCTGTCTGACTACAACTCGAGTTGTAGTCAGACAGGGTGCGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000433586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021009.4-901s21c1
Sequence:CCGGTGGGATGCAGATCTTCGTGAACTCGAGTTCACGAAGATCTGCATCCCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000434069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021009.4-1414s21c1
Sequence:CCGGGCCGAGTGACACCATTGAGAACTCGAGTTCTCAATGGTGTCACTCGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000433566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021009.4-2287s21c1
Sequence:CCGGGAAGACCCTGACTGGTAAGACCTCGAGGTCTTACCAGTCAGGGTCTTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000412861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021009.4-1064s21c1
Sequence:CCGGCGTACCCTGTCTGACTACAACCTCGAGGTTGTAGTCAGACAGGGTACGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000423348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021009.4-665s21c1
Sequence:CCGGCTCAGAGGTGGGATGCAAATCCTCGAGGATTTGCATCCCACCTCTGAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021009
VALIDATED
UBC MISSION shRNA Lentiviral Transduction Particles
ubiquitin C
Human
11 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000011111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021009.2-419s1c1
Sequence:CCGGGAGGTTGATCTTTGCCGGAAACTCGAGTTTCCGGCAAAGATCAACCTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021009.2-1518s1c1
Sequence:CCGGGCAAAGATCCAAGACAAGGAACTCGAGTTCCTTGTCTTGGATCTTTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021009.2-821s1c1
Sequence:CCGGCGAGAACGTCAAAGCAAAGATCTCGAGATCTTTGCTTTGACGTTCTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021009.2-1961s1c1
Sequence:CCGGCGAGAATGTCAAGGCAAAGATCTCGAGATCTTTGCCTTGACATTCTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021009.2-2016s1c1
Sequence:CCGGAGGTTGATCTTTGCTGGGAAACTCGAGTTTCCCAGCAAAGATCAACCTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021009.4-1747s21c1
Sequence:CCGGACGCACCCTGTCTGACTACAACTCGAGTTGTAGTCAGACAGGGTGCGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021009.4-901s21c1
Sequence:CCGGTGGGATGCAGATCTTCGTGAACTCGAGTTCACGAAGATCTGCATCCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021009.4-1414s21c1
Sequence:CCGGGCCGAGTGACACCATTGAGAACTCGAGTTCTCAATGGTGTCACTCGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021009.4-2287s21c1
Sequence:CCGGGAAGACCCTGACTGGTAAGACCTCGAGGTCTTACCAGTCAGGGTCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021009.4-1064s21c1
Sequence:CCGGCGTACCCTGTCTGACTACAACCTCGAGGTTGTAGTCAGACAGGGTACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021009.4-665s21c1
Sequence:CCGGCTCAGAGGTGGGATGCAAATCCTCGAGGATTTGCATCCCACCTCTGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)