EMAIL THIS PAGE TO A FRIEND

Ube2cbp

21 Gene Product Result for
Gene ID:
chicken(421843) ubiquitin-conjugating enzyme E2C binding protein
dog(481900) ubiquitin-conjugating enzyme E2C binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU176131 MISSION® esiRNA targeting mouse Ube2cbp mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_027394 Rosetta Predictions mouse pricing
XM_135023 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332104 predicted 1104
2 SASI_Mm02_00332105 predicted 1204
3 SASI_Mm02_00332106 predicted 370
4 SASI_Mm02_00332107 predicted 1078
5 SASI_Mm02_00332108 predicted 1065
6 SASI_Mm02_00332109 predicted 1113
7 SASI_Mm02_00332110 predicted 724
8 SASI_Mm02_00332111 predicted 938
9 SASI_Mm02_00332112 predicted 393
10 SASI_Mm02_00332113 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_135023 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239366 predicted 1138
2 SASI_Mm01_00239367 predicted 1237
3 SASI_Mm01_00239368 predicted 411
4 SASI_Mm01_00239369 predicted 1306
5 SASI_Mm01_00239370 predicted 1105
6 SASI_Mm01_00239371 predicted 1152
7 SASI_Mm01_00239372 predicted 762
8 SASI_Mm01_00239373 predicted 974
9 SASI_Mm01_00239374 predicted 435
10 SASI_Mm01_00239375 predicted 1038
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027394
VALIDATED
Ube2cbp MISSION shRNA Bacterial Glycerol Stock
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000252469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027394.2-820s21c1
Sequence:CCGGTCCTCTGCTAGAAGTACTTTCCTCGAGGAAAGTACTTCTAGCAGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027394.2-1397s21c1
Sequence:CCGGCTGCAAACTCAAGGCTATAAGCTCGAGCTTATAGCCTTGAGTTTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027394.2-717s21c1
Sequence:CCGGTTACATGACAGAGGTAATTATCTCGAGATAATTACCTCTGTCATGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027394.2-1070s21c1
Sequence:CCGGACATCAGCGTCCACCCTTTAACTCGAGTTAAAGGGTGGACGCTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027394
VALIDATED
Ube2cbp MISSION shRNA shRNA Plasmid DNA
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000252469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027394.2-820s21c1
Sequence:CCGGTCCTCTGCTAGAAGTACTTTCCTCGAGGAAAGTACTTCTAGCAGAGGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000252472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027394.2-1397s21c1
Sequence:CCGGCTGCAAACTCAAGGCTATAAGCTCGAGCTTATAGCCTTGAGTTTGCAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000252471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027394.2-717s21c1
Sequence:CCGGTTACATGACAGAGGTAATTATCTCGAGATAATTACCTCTGTCATGTAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000252470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027394.2-1070s21c1
Sequence:CCGGACATCAGCGTCCACCCTTTAACTCGAGTTAAAGGGTGGACGCTGATGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027394
VALIDATED
Ube2cbp MISSION shRNA Lentiviral Transduction Particles
Mouse
4 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (4)? Select
TRCN0000252469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027394.2-820s21c1
Sequence:CCGGTCCTCTGCTAGAAGTACTTTCCTCGAGGAAAGTACTTCTAGCAGAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027394.2-1397s21c1
Sequence:CCGGCTGCAAACTCAAGGCTATAAGCTCGAGCTTATAGCCTTGAGTTTGCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027394.2-717s21c1
Sequence:CCGGTTACATGACAGAGGTAATTATCTCGAGATAATTACCTCTGTCATGTAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027394.2-1070s21c1
Sequence:CCGGACATCAGCGTCCACCCTTTAACTCGAGTTAAAGGGTGGACGCTGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)