EMAIL THIS PAGE TO A FRIEND

UBE2E4P

ubiquitin-conjugating enzyme E2E 4 pseudogene

5 Gene Product Result for
Synonyms: UbcM2
Species: Human UBE2E4P(286480)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207353 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207353 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207353 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207353
UBE2E4P MISSION shRNA Bacterial Glycerol Stock
ubiquitin-conjugating enzyme E2E 4 pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207353.1-224s1c1
Sequence:CCGGCCCTTGATCCTCCTCCTAATTCTCGAGAATTAGGAGGAGGATCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207353.1-301s1c1
Sequence:CCGGCCACTGGGTTCTGTATATGAACTCGAGTTCATATACAGAACCCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207353.1-606s1c1
Sequence:CCGGGACCAAGAGATACGCAACGTACTCGAGTACGTTGCGTATCTCTTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207353.1-469s1c1
Sequence:CCGGGCTTTGACTGTTTCAAAGGTTCTCGAGAACCTTTGAAACAGTCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207353.1-98s1c1
Sequence:CCGGCTGAAGAACAAGAGGAAAGAACTCGAGTTCTTTCCTCTTGTTCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207353
UBE2E4P MISSION shRNA shRNA Plasmid DNA
ubiquitin-conjugating enzyme E2E 4 pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207353.1-224s1c1
Sequence:CCGGCCCTTGATCCTCCTCCTAATTCTCGAGAATTAGGAGGAGGATCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207353.1-301s1c1
Sequence:CCGGCCACTGGGTTCTGTATATGAACTCGAGTTCATATACAGAACCCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207353.1-606s1c1
Sequence:CCGGGACCAAGAGATACGCAACGTACTCGAGTACGTTGCGTATCTCTTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207353.1-469s1c1
Sequence:CCGGGCTTTGACTGTTTCAAAGGTTCTCGAGAACCTTTGAAACAGTCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207353.1-98s1c1
Sequence:CCGGCTGAAGAACAAGAGGAAAGAACTCGAGTTCTTTCCTCTTGTTCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207353
UBE2E4P MISSION shRNA Lentiviral Transduction Particles
ubiquitin-conjugating enzyme E2E 4 pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207353.1-224s1c1
Sequence:CCGGCCCTTGATCCTCCTCCTAATTCTCGAGAATTAGGAGGAGGATCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207353.1-301s1c1
Sequence:CCGGCCACTGGGTTCTGTATATGAACTCGAGTTCATATACAGAACCCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207353.1-606s1c1
Sequence:CCGGGACCAAGAGATACGCAACGTACTCGAGTACGTTGCGTATCTCTTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207353.1-469s1c1
Sequence:CCGGGCTTTGACTGTTTCAAAGGTTCTCGAGAACCTTTGAAACAGTCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207353.1-98s1c1
Sequence:CCGGCTGAAGAACAAGAGGAAAGAACTCGAGTTCTTTCCTCTTGTTCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)