UBL4A

ubiquitin-like 4A

73 Gene Product Result for

Synonyms: DX254E DXS254E G6PD GDX GET5 MDY2 TMA24 UBL4

Species: Human UBL4A(8266), Mouse Ubl4a(100169864), Rat Ubl4a(293864), cow UBL4A(504533), sheep UBL4A(101118855), naked mole-rat Ubl4a(101708338), Domestic Rabbit UBL4A(100328764), domestic guinea pig Ubl4a(100723318), domestic cat UBL4A(101085445), dog UBL4A(612563)

UniProtKB ID: P11441, Q5HY80

Gene ID:

Human(8266)

Mouse(100169864) Slc10a3-Ubl4 readthrough

Rat(293864) ubiquitin-like 4A

cow(504533) ubiquitin-like 4A

sheep(101118855) ubiquitin-like 4A

naked mole-rat(101708338) ubiquitin-like 4A

Domestic Rabbit(100328764) ubiquitin-like 4A

domestic guinea pig(100723318) ubiquitin-like 4A

domestic cat(101085445) ubiquitin-like 4A

dog(612563) ubiquitin-like 4A

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

U4634	Anti-UBL4A (33-45) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution	human	western blot	pricing

U4759	Anti-UBL4A (46-60) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution	human	western blot	pricing

SAB1406651	Anti-UBL4A antibody produced in mouse purified immunoglobulin, buffered aqueous solution	human	immunofluorescence, western blot	pricing

HPA003617	Anti-UBL4A antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	rat, mouse, human	immunohistochemistry, western blot	pricing

SAB1411482	Anti-UBL4A antibody produced in rabbit purified immunoglobulin, buffered aqueous solution	human	western blot	pricing

SAB1402982	Monoclonal Anti-UBL4A antibody produced in mouse clone 1C10, ascites fluid	human	ELISA, western blot	pricing

SAB4100265	Monoclonal Anti-UBL4A antibody produced in mouse clone UBL4A-A236, culture supernatant	human	western blot	pricing

Zinc Finger Nucleases

Product #	Description	Add to Cart

CKOZFN22400	CompoZr^® Knockout ZFN Kit Human UBL4A (NM_014235)	pricing

CKOZFN64910	CompoZr^® Knockout ZFN Kit Rat Ubl4 (NM_001106346)	pricing

CKOZFND22400	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Human UBL4A (NM_014235)	pricing

CKOZFND64910	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Rat Ubl4 (NM_001106346)	pricing

Proteins

Product #	Description	Species	Add to Cart

APREST74360	PrEST Antigen UBL4A Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST23074	SILu^™PrEST UBL4A SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

3'UTR GoClone

Product #	Description	Species	Add to Cart

HUTR10557	MISSION^® 3′UTR Lenti GoClone^™ Powered by SwitchGear Genomics^™, 3′UTR, human, UBL4A	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_014235	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_014235	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_014235	MISSION® shRNA Lentiviral Transduction Particles	human	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU052691	MISSION^® esiRNA esiRNA human UBL4A (esiRNA1)	human	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_014235	Rosetta Predictions	human	pricing
NM_001106346	Rosetta Predictions	rat	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_014235	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs02_00345271 predicted	522
2	SASI_Hs01_00047075 predicted	535
3	SASI_Hs01_00047076 predicted	710
4	SASI_Hs01_00047078 predicted	453
5	SASI_Hs01_00047079 predicted	549
6	SASI_Hs01_00047080 predicted	812
7	SASI_Hs01_00047081 predicted	228
8	SASI_Hs02_00345272 predicted	779
9	SASI_Hs02_00345273 predicted	783
10	SASI_Hs01_00047083 predicted	956
11	SASI_Hs01_00047077 predicted	449
12	SASI_Hs01_00047082 predicted	786
13	SASI_Hs01_00047084 predicted	374

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001106346	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00218068 predicted	618
2	SASI_Rn02_00218069 predicted	279
3	SASI_Rn02_00218070 predicted	953
4	SASI_Rn02_00218071 predicted	271
5	SASI_Rn02_00218072 predicted	745
6	SASI_Rn02_00218073 predicted	671
7	SASI_Rn02_00218074 predicted	539
8	SASI_Rn02_00218075 predicted	631
9	SASI_Rn02_00218076 predicted	777
10	SASI_Rn02_00218077 predicted	473

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_014235 VALIDATED	UBL4A MISSION shRNA Bacterial Glycerol Stock ubiquitin-like 4A	Human

10 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000286036
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_014235.3-402s21c1
	Sequence:CCGGGCTGGACGACATCGAACGGTTCTCGAGAACCGTTCGATGTCGTCCAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000277751
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_014235.3-232s21c1
	Sequence:CCGGGAGAAGGTGCTACTAGAAGAACTCGAGTTCTTCTAGTAGCACCTTCTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000277819
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_014235.3-441s21c1
	Sequence:CCGGCCCTGAAGTGACTGAGACAATCTCGAGATTGTCTCAGTCACTTCAGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000277750
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_014235.3-297s21c1
	Sequence:CCGGGCAGCTGATCTCCAAAGTCTTCTCGAGAAGACTTTGGAGATCAGCTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000277821
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_014235.3-1854s21c1
	Sequence:CCGGGCAGTTCAGGTGATACATTTACTCGAGTAAATGTATCACCTGAACTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000007667
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 1	Clone ID:NM_014235.2-1858s1c1
	Sequence:CCGGGCAGTTCAGGTGATACATTTACTCGAGTAAATGTATCACCTGAACTGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000007670
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 1	Clone ID:NM_014235.2-236s1c1
	Sequence:CCGGGAGAAGGTGCTACTAGAAGAACTCGAGTTCTTCTAGTAGCACCTTCTCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000007671
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_014235.2-406s1c1
	Sequence:CCGGGCTGGACGACATCGAACGGTTCTCGAGAACCGTTCGATGTCGTCCAGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000007669
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.98	Cell Line: A549
	TRC Version: 1	Clone ID:NM_014235.2-301s1c1
	Sequence:CCGGGCAGCTGATCTCCAAAGTCTTCTCGAGAAGACTTTGGAGATCAGCTGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000007668
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.87	Cell Line: A549
	TRC Version: 1	Clone ID:NM_014235.2-445s1c1
	Sequence:CCGGCCCTGAAGTGACTGAGACAATCTCGAGATTGTCTCAGTCACTTCAGGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_014235 VALIDATED	UBL4A MISSION shRNA shRNA Plasmid DNA ubiquitin-like 4A	Human

10 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000286036
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_014235.3-402s21c1
	Sequence:CCGGGCTGGACGACATCGAACGGTTCTCGAGAACCGTTCGATGTCGTCCAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000277751
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_014235.3-232s21c1
	Sequence:CCGGGAGAAGGTGCTACTAGAAGAACTCGAGTTCTTCTAGTAGCACCTTCTCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000277819
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_014235.3-441s21c1
	Sequence:CCGGCCCTGAAGTGACTGAGACAATCTCGAGATTGTCTCAGTCACTTCAGGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000277750
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_014235.3-297s21c1
	Sequence:CCGGGCAGCTGATCTCCAAAGTCTTCTCGAGAAGACTTTGGAGATCAGCTGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000277821
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_014235.3-1854s21c1
	Sequence:CCGGGCAGTTCAGGTGATACATTTACTCGAGTAAATGTATCACCTGAACTGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000007667
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 1	Clone ID:NM_014235.2-1858s1c1
	Sequence:CCGGGCAGTTCAGGTGATACATTTACTCGAGTAAATGTATCACCTGAACTGCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000007670
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 1	Clone ID:NM_014235.2-236s1c1
	Sequence:CCGGGAGAAGGTGCTACTAGAAGAACTCGAGTTCTTCTAGTAGCACCTTCTCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000007671
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_014235.2-406s1c1
	Sequence:CCGGGCTGGACGACATCGAACGGTTCTCGAGAACCGTTCGATGTCGTCCAGCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000007669
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.98	Cell Line: A549
	TRC Version: 1	Clone ID:NM_014235.2-301s1c1
	Sequence:CCGGGCAGCTGATCTCCAAAGTCTTCTCGAGAAGACTTTGGAGATCAGCTGCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000007668
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.87	Cell Line: A549
	TRC Version: 1	Clone ID:NM_014235.2-445s1c1
	Sequence:CCGGCCCTGAAGTGACTGAGACAATCTCGAGATTGTCTCAGTCACTTCAGGGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_014235 VALIDATED	UBL4A MISSION shRNA Lentiviral Transduction Particles ubiquitin-like 4A	Human

10 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000286036
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_014235.3-402s21c1
	Sequence:CCGGGCTGGACGACATCGAACGGTTCTCGAGAACCGTTCGATGTCGTCCAGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000277751
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_014235.3-232s21c1
	Sequence:CCGGGAGAAGGTGCTACTAGAAGAACTCGAGTTCTTCTAGTAGCACCTTCTCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000277819
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_014235.3-441s21c1
	Sequence:CCGGCCCTGAAGTGACTGAGACAATCTCGAGATTGTCTCAGTCACTTCAGGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000277750
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_014235.3-297s21c1
	Sequence:CCGGGCAGCTGATCTCCAAAGTCTTCTCGAGAAGACTTTGGAGATCAGCTGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000277821
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_014235.3-1854s21c1
	Sequence:CCGGGCAGTTCAGGTGATACATTTACTCGAGTAAATGTATCACCTGAACTGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000007667
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 1	Clone ID:NM_014235.2-1858s1c1
	Sequence:CCGGGCAGTTCAGGTGATACATTTACTCGAGTAAATGTATCACCTGAACTGCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000007670
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 1	Clone ID:NM_014235.2-236s1c1
	Sequence:CCGGGAGAAGGTGCTACTAGAAGAACTCGAGTTCTTCTAGTAGCACCTTCTCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000007671
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_014235.2-406s1c1
	Sequence:CCGGGCTGGACGACATCGAACGGTTCTCGAGAACCGTTCGATGTCGTCCAGCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000007669
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.98	Cell Line: A549
	TRC Version: 1	Clone ID:NM_014235.2-301s1c1
	Sequence:CCGGGCAGCTGATCTCCAAAGTCTTCTCGAGAAGACTTTGGAGATCAGCTGCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000007668
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.87	Cell Line: A549
	TRC Version: 1	Clone ID:NM_014235.2-445s1c1
	Sequence:CCGGCCCTGAAGTGACTGAGACAATCTCGAGATTGTCTCAGTCACTTCAGGGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

Service & Support

Ordering

Corporate

© 2018 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved. Reproduction of any materials from the site is strictly forbidden without permission. Sigma-Aldrich Products are sold exclusively through Sigma-Aldrich, Inc. Site Use Terms | Privacy