EMAIL THIS PAGE TO A FRIEND

UGT1A4

UDP glucuronosyltransferase 1 family, polypeptide A4

59 Gene Product Result for
Synonyms: HUG-BR2 UDPGT UDPGT 1-4 UGT-1D UGT1-04 UGT1.4 UGT1D
UniProtKB ID: P22310, B2R937, Q5DT00
Gene ID:
Human(54657) Summary: This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. This enzyme has some glucuronidase activity towards bilirubin, although is is more active on amines, steroids, and sapogenins. [provided by RefSeq, Jul 2008]
sheep(100534646) UDP glucuronosyltransferase 1 family, polypeptide A4
Zebrafish(100384901) UDP glucuronosyltransferase 1 family, polypeptide A4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV46829 Anti-UGT1A4 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300890 Anti-UGT1A4 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007120 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007120 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007120 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU222991 MISSION® esiRNA esiRNA targeting human UGT1A4 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007120 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082569 predicted 2113
2 SASI_Hs01_00082570 predicted 1698
3 SASI_Hs01_00082572 predicted 2027
4 SASI_Hs02_00342992 predicted 1930
5 SASI_Hs01_00082573 predicted 1556
6 SASI_Hs01_00082574 predicted 2026
7 SASI_Hs01_00082575 predicted 2114
8 SASI_Hs01_00082576 predicted 2043
9 SASI_Hs01_00082578 predicted 2108
10 SASI_Hs02_00342993 predicted 1608
11 SASI_Hs01_00082571 predicted 1597
12 SASI_Hs01_00082577 predicted 1553
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007120
UGT1A4 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 1 family, polypeptide A4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007120.2-356s21c1
Sequence:CCGGATATTCTAGAAGTATGGCAATCTCGAGATTGCCATACTTCTAGAATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007120.2-303s21c1
Sequence:CCGGGTTACGCTGGGCTACACTCAACTCGAGTTGAGTGTAGCCCAGCGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007120.2-601s21c1
Sequence:CCGGCCTCCTATATTCCTAAGTTACCTCGAGGTAACTTAGGAATATAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-259s1c1
Sequence:CCGGTGACAGCCTATGCTGTTCCATCTCGAGATGGAACAGCATAGGCTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-286s1c1
Sequence:CCGGAGAAGGAATTTGATCGCGTTACTCGAGTAACGCGATCAAATTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-612s1c1
Sequence:CCGGCCTAAGTTACTAACGACCAATCTCGAGATTGGTCGTTAGTAACTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-339s1c1
Sequence:CCGGGAACATCTTCTGAAGAGATATCTCGAGATATCTCTTCAGAAGATGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-391s1c1
Sequence:CCGGCTTTGGCCCTTCATAGGTGTTCTCGAGAACACCTATGAAGGGCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007120
UGT1A4 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 1 family, polypeptide A4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007120.2-356s21c1
Sequence:CCGGATATTCTAGAAGTATGGCAATCTCGAGATTGCCATACTTCTAGAATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007120.2-303s21c1
Sequence:CCGGGTTACGCTGGGCTACACTCAACTCGAGTTGAGTGTAGCCCAGCGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007120.2-601s21c1
Sequence:CCGGCCTCCTATATTCCTAAGTTACCTCGAGGTAACTTAGGAATATAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-259s1c1
Sequence:CCGGTGACAGCCTATGCTGTTCCATCTCGAGATGGAACAGCATAGGCTGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-286s1c1
Sequence:CCGGAGAAGGAATTTGATCGCGTTACTCGAGTAACGCGATCAAATTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-612s1c1
Sequence:CCGGCCTAAGTTACTAACGACCAATCTCGAGATTGGTCGTTAGTAACTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-339s1c1
Sequence:CCGGGAACATCTTCTGAAGAGATATCTCGAGATATCTCTTCAGAAGATGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-391s1c1
Sequence:CCGGCTTTGGCCCTTCATAGGTGTTCTCGAGAACACCTATGAAGGGCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007120
UGT1A4 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 1 family, polypeptide A4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007120.2-356s21c1
Sequence:CCGGATATTCTAGAAGTATGGCAATCTCGAGATTGCCATACTTCTAGAATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007120.2-303s21c1
Sequence:CCGGGTTACGCTGGGCTACACTCAACTCGAGTTGAGTGTAGCCCAGCGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007120.2-601s21c1
Sequence:CCGGCCTCCTATATTCCTAAGTTACCTCGAGGTAACTTAGGAATATAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-259s1c1
Sequence:CCGGTGACAGCCTATGCTGTTCCATCTCGAGATGGAACAGCATAGGCTGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-286s1c1
Sequence:CCGGAGAAGGAATTTGATCGCGTTACTCGAGTAACGCGATCAAATTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-612s1c1
Sequence:CCGGCCTAAGTTACTAACGACCAATCTCGAGATTGGTCGTTAGTAACTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-339s1c1
Sequence:CCGGGAACATCTTCTGAAGAGATATCTCGAGATATCTCTTCAGAAGATGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007120.2-391s1c1
Sequence:CCGGCTTTGGCCCTTCATAGGTGTTCTCGAGAACACCTATGAAGGGCCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)