EMAIL THIS PAGE TO A FRIEND

UGT2B11

UDP glucuronosyltransferase 2 family, polypeptide B11

6 Gene Product Result for
Species: Human UGT2B11(10720)
UniProtKB ID: O75310, Q3KNV9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302627 ANTI-UGT2B11 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001073 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001073 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001073 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001073 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001073 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130098 predicted 354
2 SASI_Hs01_00130099 predicted 1627
3 SASI_Hs01_00130100 predicted 1618
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001073
UGT2B11 MISSION shRNA Bacterial Glycerol Stock
UDP glucuronosyltransferase 2 family, polypeptide B11
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001073.1-493s1c1
Sequence:CCGGGCGCTACTTAACATACGGTTTCTCGAGAAACCGTATGTTAAGTAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001073.1-1029s1c1
Sequence:CCGGCGGGAATAAACCAGATGCCTTCTCGAGAAGGCATCTGGTTTATTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001073.1-99s1c1
Sequence:CCGGCGCAGAATACAGCCATTGGATCTCGAGATCCAATGGCTGTATTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001073.1-354s1c1
Sequence:CCGGCCTGTGGGAATTATATGACATCTCGAGATGTCATATAATTCCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001073.1-874s1c1
Sequence:CCGGCCTAAGGAAATGGAGGAGTTTCTCGAGAAACTCCTCCATTTCCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001073.1-816s21c1
Sequence:CCGGATTCTTACCAAACGTTGATTTCTCGAGAAATCAACGTTTGGTAAGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001073.1-1199s21c1
Sequence:CCGGTTGATCAACCTGATAACATTGCTCGAGCAATGTTATCAGGTTGATCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001073.1-209s21c1
Sequence:CCGGATGATGCATCCACTCTTAAATCTCGAGATTTAAGAGTGGATGCATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001073
UGT2B11 MISSION shRNA shRNA Plasmid DNA
UDP glucuronosyltransferase 2 family, polypeptide B11
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001073.1-493s1c1
Sequence:CCGGGCGCTACTTAACATACGGTTTCTCGAGAAACCGTATGTTAAGTAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001073.1-1029s1c1
Sequence:CCGGCGGGAATAAACCAGATGCCTTCTCGAGAAGGCATCTGGTTTATTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001073.1-99s1c1
Sequence:CCGGCGCAGAATACAGCCATTGGATCTCGAGATCCAATGGCTGTATTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001073.1-354s1c1
Sequence:CCGGCCTGTGGGAATTATATGACATCTCGAGATGTCATATAATTCCCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001073.1-874s1c1
Sequence:CCGGCCTAAGGAAATGGAGGAGTTTCTCGAGAAACTCCTCCATTTCCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001073.1-816s21c1
Sequence:CCGGATTCTTACCAAACGTTGATTTCTCGAGAAATCAACGTTTGGTAAGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001073.1-1199s21c1
Sequence:CCGGTTGATCAACCTGATAACATTGCTCGAGCAATGTTATCAGGTTGATCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001073.1-209s21c1
Sequence:CCGGATGATGCATCCACTCTTAAATCTCGAGATTTAAGAGTGGATGCATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001073
UGT2B11 MISSION shRNA Lentiviral Transduction Particles
UDP glucuronosyltransferase 2 family, polypeptide B11
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001073.1-493s1c1
Sequence:CCGGGCGCTACTTAACATACGGTTTCTCGAGAAACCGTATGTTAAGTAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001073.1-1029s1c1
Sequence:CCGGCGGGAATAAACCAGATGCCTTCTCGAGAAGGCATCTGGTTTATTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001073.1-99s1c1
Sequence:CCGGCGCAGAATACAGCCATTGGATCTCGAGATCCAATGGCTGTATTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001073.1-354s1c1
Sequence:CCGGCCTGTGGGAATTATATGACATCTCGAGATGTCATATAATTCCCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001073.1-874s1c1
Sequence:CCGGCCTAAGGAAATGGAGGAGTTTCTCGAGAAACTCCTCCATTTCCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001073.1-816s21c1
Sequence:CCGGATTCTTACCAAACGTTGATTTCTCGAGAAATCAACGTTTGGTAAGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001073.1-1199s21c1
Sequence:CCGGTTGATCAACCTGATAACATTGCTCGAGCAATGTTATCAGGTTGATCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001073.1-209s21c1
Sequence:CCGGATGATGCATCCACTCTTAAATCTCGAGATTTAAGAGTGGATGCATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)