EMAIL THIS PAGE TO A FRIEND

UQCRHL

7 Gene Product Result for
Species: Human UQCRHL(440567)
Gene ID:
Human(440567) Summary: This gene has characteristics of a pseudogene derived from the UQCRH gene. However, there is still an open reading frame that could produce a protein of the same or nearly the same size as that of the UQCRH gene, so this gene is being called protein-coding for now. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA042574 Anti-UQCRH antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001089591 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001089591 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001089591 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001089591 Rosetta Predictions human pricing
XM_496348 Rosetta Predictions human pricing
XM_934930 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001089591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318051 predicted 193
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296494 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269781 predicted 1841
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001089591
UQCRHL MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000272321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001089591.1-358s21c1
Sequence:CCGGCATCTGGGCATCAGAATATTTCTCGAGAAATATTCTGATGCCCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089591.1-218s21c1
Sequence:CCGGTGTATCCTCTCGATCACATACCTCGAGGTATGTGATCGAGAGGATACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089591.1-165s21c1
Sequence:CCGGCAGTTGGAGAAATGTGTAAAGCTCGAGCTTTACACATTTCTCCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089591.1-264s21c1
Sequence:CCGGTTTGACTTCTTGCATGCAAAGCTCGAGCTTTGCATGCAAGAAGTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001089591
UQCRHL MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000272321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001089591.1-358s21c1
Sequence:CCGGCATCTGGGCATCAGAATATTTCTCGAGAAATATTCTGATGCCCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089591.1-218s21c1
Sequence:CCGGTGTATCCTCTCGATCACATACCTCGAGGTATGTGATCGAGAGGATACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089591.1-165s21c1
Sequence:CCGGCAGTTGGAGAAATGTGTAAAGCTCGAGCTTTACACATTTCTCCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089591.1-264s21c1
Sequence:CCGGTTTGACTTCTTGCATGCAAAGCTCGAGCTTTGCATGCAAGAAGTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001089591
UQCRHL MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000272321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001089591.1-358s21c1
Sequence:CCGGCATCTGGGCATCAGAATATTTCTCGAGAAATATTCTGATGCCCAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089591.1-218s21c1
Sequence:CCGGTGTATCCTCTCGATCACATACCTCGAGGTATGTGATCGAGAGGATACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089591.1-165s21c1
Sequence:CCGGCAGTTGGAGAAATGTGTAAAGCTCGAGCTTTACACATTTCTCCAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089591.1-264s21c1
Sequence:CCGGTTTGACTTCTTGCATGCAAAGCTCGAGCTTTGCATGCAAGAAGTCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)