EMAIL THIS PAGE TO A FRIEND

VDR

vitamin D (1,25- dihydroxyvitamin D3) receptor

105 Gene Product Result for
Synonyms: NR1I1
UniProtKB ID: P11473, B2R5Q1, G3V1V9, Q5PSV3
Gene ID:
Human(7421) Summary: This gene encodes the nuclear hormone receptor for vitamin D3. This receptor also functions as a receptor for the secondary bile acid lithocholic acid. The receptor belongs to the family of trans-acting transcriptional regulatory factors and shows sequence similarity to the steroid and thyroid hormone receptors. Downstream targets of this nuclear hormone receptor are principally involved in mineral metabolism though the receptor regulates a variety of other metabolic pathways, such as those involved in the immune response and cancer. Mutations in this gene are associated with type II vitamin D-resistant rickets. A single nucleotide polymorphism in the initiation codon results in an alternate translation start site three codons downstream. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Feb 2011]
Mouse(22337) vitamin D receptor
Rat(24873) vitamin D (1,25- dihydroxyvitamin D3) receptor
chicken(395988) vitamin D (1,25- dihydroxyvitamin D3) receptor
dog(486588) vitamin D (1,25- dihydroxyvitamin D3) receptor
Horse(100034072) vitamin D (1,25- dihydroxyvitamin D3) receptor
domestic cat(100316614) vitamin D (1,25- dihydroxyvitamin D3) receptor
cow(533656) vitamin D (1,25- dihydroxyvitamin D3) receptor
sheep(101107273) vitamin D (1,25- dihydroxyvitamin D3) receptor
sheep(100294603) vitamin D (1,25- dihydroxyvitamin D3) receptor
naked mole-rat(101710294) vitamin D (1,25- dihydroxyvitamin D3) receptor
domestic guinea pig(100734655) vitamin D (1,25- dihydroxyvitamin D3) receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
17946 1α-Hydroxyvitamin D3 ≥97.0% (HPLC) human pricing
H4014 25-Hydroxycholecalciferol ≥98% (HPLC) human pricing
17938 25-Hydroxyvitamin D3 monohydrate ≥99.0% (HPLC) human pricing
H-083 25-Hydroxyvitamin D3 solution 100 μg/mL in ethanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
739650 25-Hydroxyvitamin D3 solution 100 μg/mL in ethanol, 98% (CP) human pricing
H-086 25-Hydroxyvitamin D3 solution 5 μg/mL in ethanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
739642 25-Hydroxyvitamin D3 solution 50 μg/mL in ethanol, 98% (CP) human pricing
739669 25-Hydroxyvitamin D3 solution 5 μg/mL in ethanol, 98% (CP) human pricing
A0325450 Alfacalcidol European Pharmacopoeia (EP) Reference Standard human pricing
Y0002137 Alfacalcidol for impurity B identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0001601 Alfacalcidol for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
Y0002125 Alfacalcidol for system suitability A European Pharmacopoeia (EP) Reference Standard human pricing
C0166000 Calcifediol European Pharmacopoeia (EP) Reference Standard human pricing
1086108 Calcifediol United States Pharmacopeia (USP) Reference Standard human pricing
Y0002040 Calcifediol for impurity D identification European Pharmacopoeia (EP) Reference Standard human pricing
C0225000 Calcitriol European Pharmacopoeia (EP) Reference Standard human pricing
C9756 Cholecalciferol ≥98% (HPLC) human pricing
C1357 Cholecalciferol meets USP testing specifications human pricing
1131009 Cholecalciferol United States Pharmacopeia (USP) Reference Standard human pricing
C9774 Cholecalciferol analytical standard human pricing
C2100000 Cholecalciferol European Pharmacopoeia (EP) Reference Standard human pricing
47763 Cholecalciferol (D3) analytical standard human pricing
PHR1237 Cholecalciferol (Vitamin D3) Pharmaceutical Secondary Standard; Certified Reference Material human pricing
C2150000 Cholecalciferol for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
BP787 Colecalciferol British Pharmacopoeia (BP) Reference Standard human pricing
1225601 Doxercalciferol United States Pharmacopeia (USP) Reference Standard human pricing
D0196 Doxercalciferol ≥98% (HPLC), solubility: >10 mg/mL in DMSO human pricing
E5750 Ergocalciferol 40,000,000 USP units/g human pricing
95220 Ergocalciferol ≥98.0% (sum of enantiomers, HPLC) human pricing
1239005 Ergocalciferol United States Pharmacopeia (USP) Reference Standard human pricing
E0900000 Ergocalciferol European Pharmacopoeia (EP) Reference Standard human pricing
BP788 Ergocalciferol British Pharmacopoeia (BP) Reference Standard human pricing
E1007 Ergocalciferol Sigma Reference Standard human pricing
47768 Ergocalciferol (D2) analytical standard human pricing
PHR1238 Ergocalciferol (Vitamin D2) Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0001375 Ergocalciferol for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
V-024 Vitamin D2 solution 1 mg/mL in ethanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
740306 Vitamin D2 solution 100 μg/mL in ethanol, 98% (CP) human pricing
V-025 Vitamin D3 solution 1 mg/mL in ethanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
740292 Vitamin D3 solution 100 μg/mL in ethanol, 97% (CP) human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
D1530 1α,25-Dihydroxyvitamin D3 ≥99% (HPLC) human pricing
17936 1α,25-Dihydroxyvitamin D3 ≥97.0% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009504 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009504 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009504 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000376 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010441 MISSION® esiRNA targeting human VDR human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000376 Rosetta Predictions human pricing
NM_001017535 Rosetta Predictions human pricing
NM_017058 Rosetta Predictions rat pricing
NM_009504 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068008 predicted 767
2 SASI_Hs01_00068009 predicted 964
3 SASI_Hs01_00068010 predicted 463
4 SASI_Hs01_00068011 predicted 1427
5 SASI_Hs01_00068012 predicted 1114
6 SASI_Hs02_00302434 predicted 770
7 SASI_Hs01_00068013 predicted 1578
8 SASI_Hs01_00068014 predicted 391
9 SASI_Hs01_00068015 predicted 291
10 SASI_Hs02_00302435 predicted 896
11 SASI_Hs01_00068007 predicted 317
12 SASI_Hs01_00068016 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167284 predicted 885
2 SASI_Hs01_00167285 predicted 1081
3 SASI_Hs01_00167286 predicted 589
4 SASI_Hs01_00167287 predicted 1548
5 SASI_Hs01_00167288 predicted 1234
6 SASI_Hs02_00306796 predicted 897
7 SASI_Hs01_00167289 predicted 1704
8 SASI_Hs01_00167290 predicted 518
9 SASI_Hs01_00167291 predicted 416
10 SASI_Hs02_00306797 predicted 1012
11 SASI_Hs01_00167283 predicted 436
12 SASI_Hs01_00167292 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017058 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048362 predicted 397
2 SASI_Rn01_00048363 predicted 850
3 SASI_Rn01_00048364 predicted 567
4 SASI_Rn01_00048365 predicted 913
5 SASI_Rn01_00048367 predicted 872
6 SASI_Rn01_00048368 predicted 886
7 SASI_Rn01_00048369 predicted 809
8 SASI_Rn01_00048370 predicted 703
9 SASI_Rn01_00048371 predicted 861
10 SASI_Rn02_00261248 predicted 237
11 SASI_Rn01_00048366 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009504 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067274 predicted 896
2 SASI_Mm01_00067275 predicted 604
3 SASI_Mm01_00067276 predicted 380
4 SASI_Mm01_00067277 predicted 325
5 SASI_Mm01_00067278 predicted 924
6 SASI_Mm01_00067279 predicted 617
7 SASI_Mm01_00067280 predicted 1298
8 SASI_Mm01_00067281 predicted 244
9 SASI_Mm01_00067282 predicted 927
10 SASI_Mm01_00067283 predicted 899
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009504
VALIDATED
VDR MISSION shRNA Bacterial Glycerol Stock
vitamin D (1,25- dihydroxyvitamin D3) receptor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-620s21c1
Sequence:CCGGCGTAAGTACAGGGAGCTATTCCTCGAGGAATAGCTCCCTGTACTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-3061s21c1
Sequence:CCGGCCTGAGATCAATCACATTTAACTCGAGTTAAATGTGATTGATCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-392s21c1
Sequence:CCGGCGTGGACATTGGCATGATGAACTCGAGTTCATCATGCCAATGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-812s21c1
Sequence:CCGGCCTGGCTGATCTTGTCAGTTACTCGAGTAACTGACAAGATCAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009504.2-996s1c1
Sequence:CCGGCCAAGACTACAAATATGACATCTCGAGATGTCATATTTGTAGTCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009504.2-3062s1c1
Sequence:CCGGCCTGAGATCAATCACATTTAACTCGAGTTAAATGTGATTGATCTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009504.2-813s1c1
Sequence:CCGGCCTGGCTGATCTTGTCAGTTACTCGAGTAACTGACAAGATCAGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009504.2-393s1c1
Sequence:CCGGCGTGGACATTGGCATGATGAACTCGAGTTCATCATGCCAATGTCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009504.2-675s1c1
Sequence:CCGGCTCCTCAAACTCTGATCTGTACTCGAGTACAGATCAGAGTTTGAGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009504
VALIDATED
VDR MISSION shRNA shRNA Plasmid DNA
vitamin D (1,25- dihydroxyvitamin D3) receptor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-620s21c1
Sequence:CCGGCGTAAGTACAGGGAGCTATTCCTCGAGGAATAGCTCCCTGTACTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-3061s21c1
Sequence:CCGGCCTGAGATCAATCACATTTAACTCGAGTTAAATGTGATTGATCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-392s21c1
Sequence:CCGGCGTGGACATTGGCATGATGAACTCGAGTTCATCATGCCAATGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-812s21c1
Sequence:CCGGCCTGGCTGATCTTGTCAGTTACTCGAGTAACTGACAAGATCAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009504.2-996s1c1
Sequence:CCGGCCAAGACTACAAATATGACATCTCGAGATGTCATATTTGTAGTCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009504.2-3062s1c1
Sequence:CCGGCCTGAGATCAATCACATTTAACTCGAGTTAAATGTGATTGATCTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009504.2-813s1c1
Sequence:CCGGCCTGGCTGATCTTGTCAGTTACTCGAGTAACTGACAAGATCAGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009504.2-393s1c1
Sequence:CCGGCGTGGACATTGGCATGATGAACTCGAGTTCATCATGCCAATGTCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009504.2-675s1c1
Sequence:CCGGCTCCTCAAACTCTGATCTGTACTCGAGTACAGATCAGAGTTTGAGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009504
VALIDATED
VDR MISSION shRNA Lentiviral Transduction Particles
vitamin D (1,25- dihydroxyvitamin D3) receptor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-620s21c1
Sequence:CCGGCGTAAGTACAGGGAGCTATTCCTCGAGGAATAGCTCCCTGTACTTACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000328259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-3061s21c1
Sequence:CCGGCCTGAGATCAATCACATTTAACTCGAGTTAAATGTGATTGATCTCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000328257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-392s21c1
Sequence:CCGGCGTGGACATTGGCATGATGAACTCGAGTTCATCATGCCAATGTCCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000328258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-812s21c1
Sequence:CCGGCCTGGCTGATCTTGTCAGTTACTCGAGTAACTGACAAGATCAGCCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009504.2-996s1c1
Sequence:CCGGCCAAGACTACAAATATGACATCTCGAGATGTCATATTTGTAGTCTTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009504.2-3062s1c1
Sequence:CCGGCCTGAGATCAATCACATTTAACTCGAGTTAAATGTGATTGATCTCAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009504.2-813s1c1
Sequence:CCGGCCTGGCTGATCTTGTCAGTTACTCGAGTAACTGACAAGATCAGCCAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009504.2-393s1c1
Sequence:CCGGCGTGGACATTGGCATGATGAACTCGAGTTCATCATGCCAATGTCCACGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009504.2-675s1c1
Sequence:CCGGCTCCTCAAACTCTGATCTGTACTCGAGTACAGATCAGAGTTTGAGGAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000376
VALIDATED
VDR MISSION shRNA Bacterial Glycerol Stock
vitamin D (1,25- dihydroxyvitamin D3) receptor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-885s21c1
Sequence:CCGGTTGGCTTTGCTAAGATGATACCTCGAGGTATCATCTTAGCAAAGCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-623s21c1
Sequence:CCGGCCTCCAGTTCGTGTGAATGATCTCGAGATCATTCACACGAACTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000376.2-713s21c1
Sequence:CCGGTCCTGCTCAGATCACTGTATCCTCGAGGATACAGTGATCTGAGCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-314s21c1
Sequence:CCGGATGAAGCGGAAGGCACTATTCCTCGAGGAATAGTGCCTTCCGCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000376.1-1001s1c1
Sequence:CCGGCGCGTCAGTGACGTGACCAAACTCGAGTTTGGTCACGTCACTGACGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000376.1-578s1c1
Sequence:CCGGCCTCCAGTTCGTGTGAATGATCTCGAGATCATTCACACGAACTGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000376.1-923s1c1
Sequence:CCGGGTCATCATGTTGCGCTCCAATCTCGAGATTGGAGCGCAACATGATGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-1878s21c1
Sequence:CCGGCTCCTGCCTACTCACGATAAACTCGAGTTTATCGTGAGTAGGCAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000376.1-1372s1c1
Sequence:CCGGCGAAGTGTTTGGCAATGAGATCTCGAGATCTCATTGCCAAACACTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000376.1-151s1c1
Sequence:CCGGCCCTGGAGACTTTGACCGGAACTCGAGTTCCGGTCAAAGTCTCCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000376
VALIDATED
VDR MISSION shRNA shRNA Plasmid DNA
vitamin D (1,25- dihydroxyvitamin D3) receptor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-885s21c1
Sequence:CCGGTTGGCTTTGCTAAGATGATACCTCGAGGTATCATCTTAGCAAAGCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-623s21c1
Sequence:CCGGCCTCCAGTTCGTGTGAATGATCTCGAGATCATTCACACGAACTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000376.2-713s21c1
Sequence:CCGGTCCTGCTCAGATCACTGTATCCTCGAGGATACAGTGATCTGAGCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-314s21c1
Sequence:CCGGATGAAGCGGAAGGCACTATTCCTCGAGGAATAGTGCCTTCCGCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000376.1-1001s1c1
Sequence:CCGGCGCGTCAGTGACGTGACCAAACTCGAGTTTGGTCACGTCACTGACGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000376.1-578s1c1
Sequence:CCGGCCTCCAGTTCGTGTGAATGATCTCGAGATCATTCACACGAACTGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000376.1-923s1c1
Sequence:CCGGGTCATCATGTTGCGCTCCAATCTCGAGATTGGAGCGCAACATGATGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-1878s21c1
Sequence:CCGGCTCCTGCCTACTCACGATAAACTCGAGTTTATCGTGAGTAGGCAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000376.1-1372s1c1
Sequence:CCGGCGAAGTGTTTGGCAATGAGATCTCGAGATCTCATTGCCAAACACTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000376.1-151s1c1
Sequence:CCGGCCCTGGAGACTTTGACCGGAACTCGAGTTCCGGTCAAAGTCTCCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000376
VALIDATED
VDR MISSION shRNA Lentiviral Transduction Particles
vitamin D (1,25- dihydroxyvitamin D3) receptor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-885s21c1
Sequence:CCGGTTGGCTTTGCTAAGATGATACCTCGAGGTATCATCTTAGCAAAGCCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000276542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-623s21c1
Sequence:CCGGCCTCCAGTTCGTGTGAATGATCTCGAGATCATTCACACGAACTGGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000276541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000376.2-713s21c1
Sequence:CCGGTCCTGCTCAGATCACTGTATCCTCGAGGATACAGTGATCTGAGCAGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000277001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-314s21c1
Sequence:CCGGATGAAGCGGAAGGCACTATTCCTCGAGGAATAGTGCCTTCCGCTTCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000019508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000376.1-1001s1c1
Sequence:CCGGCGCGTCAGTGACGTGACCAAACTCGAGTTTGGTCACGTCACTGACGCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000019506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000376.1-578s1c1
Sequence:CCGGCCTCCAGTTCGTGTGAATGATCTCGAGATCATTCACACGAACTGGAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000019505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000376.1-923s1c1
Sequence:CCGGGTCATCATGTTGCGCTCCAATCTCGAGATTGGAGCGCAACATGATGACTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000276543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-1878s21c1
Sequence:CCGGCTCCTGCCTACTCACGATAAACTCGAGTTTATCGTGAGTAGGCAGGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000019504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000376.1-1372s1c1
Sequence:CCGGCGAAGTGTTTGGCAATGAGATCTCGAGATCTCATTGCCAAACACTTCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000019507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000376.1-151s1c1
Sequence:CCGGCCCTGGAGACTTTGACCGGAACTCGAGTTCCGGTCAAAGTCTCCAGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???