EMAIL THIS PAGE TO A FRIEND

Whrn

90 Gene Product Result for
Species: Mouse Whrn(73750)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028640 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028640 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028640 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008791 Rosetta Predictions mouse pricing
NM_001008792 Rosetta Predictions mouse pricing
NM_001008793 Rosetta Predictions mouse pricing
NM_001008794 Rosetta Predictions mouse pricing
NM_001008795 Rosetta Predictions mouse pricing
NM_001008796 Rosetta Predictions mouse pricing
NM_001008797 Rosetta Predictions mouse pricing
NM_001008798 Rosetta Predictions mouse pricing
NM_028640 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008791 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191962 predicted 3424
2 SASI_Mm01_00191963 predicted 3272
3 SASI_Mm01_00191964 predicted 3447
4 SASI_Mm01_00191965 predicted 3299
5 SASI_Mm01_00191966 predicted 3322
6 SASI_Mm01_00191967 predicted 3588
7 SASI_Mm01_00191968 predicted 3439
8 SASI_Mm01_00191969 predicted 3429
9 SASI_Mm01_00191970 predicted 3425
10 SASI_Mm01_00191971 predicted 3221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008792 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053736 predicted 3397
2 SASI_Mm01_00053737 predicted 3244
3 SASI_Mm01_00053738 predicted 3425
4 SASI_Mm01_00053739 predicted 3276
5 SASI_Mm01_00053740 predicted 3292
6 SASI_Mm01_00053741 predicted 3567
7 SASI_Mm01_00053742 predicted 3409
8 SASI_Mm01_00053743 predicted 3414
9 SASI_Mm01_00053744 predicted 3401
10 SASI_Mm01_00053745 predicted 3199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008793 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090252 predicted 3387
2 SASI_Mm01_00090253 predicted 3230
3 SASI_Mm01_00090254 predicted 3405
4 SASI_Mm01_00090255 predicted 3269
5 SASI_Mm01_00090256 predicted 3285
6 SASI_Mm01_00090257 predicted 3553
7 SASI_Mm01_00090258 predicted 3399
8 SASI_Mm01_00090259 predicted 3397
9 SASI_Mm01_00090260 predicted 3383
10 SASI_Mm01_00090261 predicted 3176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179831 predicted 2038
2 SASI_Mm01_00179832 predicted 1887
3 SASI_Mm01_00179833 predicted 2057
4 SASI_Mm01_00179834 predicted 1912
5 SASI_Mm01_00179835 predicted 1933
6 SASI_Mm01_00179836 predicted 2205
7 SASI_Mm01_00179837 predicted 2052
8 SASI_Mm01_00179838 predicted 2044
9 SASI_Mm01_00179839 predicted 2040
10 SASI_Mm01_00179840 predicted 1837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038555 predicted 2004
2 SASI_Mm01_00038556 predicted 1848
3 SASI_Mm01_00038557 predicted 2027
4 SASI_Mm01_00038558 predicted 1884
5 SASI_Mm01_00038559 predicted 1896
6 SASI_Mm01_00038560 predicted 2180
7 SASI_Mm01_00038561 predicted 2018
8 SASI_Mm01_00038562 predicted 2014
9 SASI_Mm01_00038563 predicted 2006
10 SASI_Mm01_00038564 predicted 1798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008796 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077728 predicted 1787
2 SASI_Mm01_00077729 predicted 1639
3 SASI_Mm01_00077730 predicted 1812
4 SASI_Mm01_00077731 predicted 1668
5 SASI_Mm01_00077732 predicted 1690
6 SASI_Mm01_00077733 predicted 1963
7 SASI_Mm01_00077734 predicted 1806
8 SASI_Mm01_00077735 predicted 1797
9 SASI_Mm01_00077736 predicted 1796
10 SASI_Mm01_00077737 predicted 1591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008797 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117267 predicted 1909
2 SASI_Mm01_00117268 predicted 1753
3 SASI_Mm01_00117269 predicted 1927
4 SASI_Mm01_00117270 predicted 1785
5 SASI_Mm01_00117271 predicted 1801
6 SASI_Mm01_00117272 predicted 2077
7 SASI_Mm01_00117273 predicted 1921
8 SASI_Mm01_00117274 predicted 1915
9 SASI_Mm01_00117275 predicted 1908
10 SASI_Mm01_00117276 predicted 1701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158459 predicted 2243
2 SASI_Mm01_00158460 predicted 2090
3 SASI_Mm01_00158461 predicted 2268
4 SASI_Mm01_00158462 predicted 2121
5 SASI_Mm01_00158463 predicted 2136
6 SASI_Mm01_00158464 predicted 2411
7 SASI_Mm01_00158465 predicted 2257
8 SASI_Mm01_00158466 predicted 2253
9 SASI_Mm01_00158467 predicted 2243
10 SASI_Mm01_00158468 predicted 2032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028640 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024922 predicted 3387
2 SASI_Mm01_00024923 predicted 3233
3 SASI_Mm01_00024924 predicted 3412
4 SASI_Mm01_00024925 predicted 3265
5 SASI_Mm01_00024926 predicted 3283
6 SASI_Mm01_00024927 predicted 3562
7 SASI_Mm01_00024928 predicted 3406
8 SASI_Mm01_00024929 predicted 3396
9 SASI_Mm01_00024930 predicted 3387
10 SASI_Mm01_00024931 predicted 3184
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028640
Whrn MISSION shRNA Bacterial Glycerol Stock
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028640.1-3392s1c1
Sequence:CCGGGAGAGAGACTACATCGACTTTCTCGAGAAAGTCGATGTAGTCTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028640.1-2413s1c1
Sequence:CCGGGTCTGTGGATGATGTCAAATCCTCGAGGATTTGACATCATCCACAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028640.1-1618s1c1
Sequence:CCGGGTACGGCCTTGGCATTTACATCTCGAGATGTAAATGCCAAGGCCGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190767    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028640.1-3722s1c1
Sequence:CCGGGAGAGTTCACACAGACTGCTTCTCGAGAAGCAGTCTGTGTGAACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028640.1-3274s1c1
Sequence:CCGGCCATAACTGTGGACAGCTCAACTCGAGTTGAGCTGTCCACAGTTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028640.1-3564s1c1
Sequence:CCGGGCAAGCAGAAAGTCAGGTTAACTCGAGTTAACCTGACTTTCTGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028640.1-3065s1c1
Sequence:CCGGGCATCCGCTAAGAACAAGAATCTCGAGATTCTTGTTCTTAGCGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028640.1-3301s1c1
Sequence:CCGGCCACGTAATTCTGGAAGTGAACTCGAGTTCACTTCCAGAATTACGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028640
Whrn MISSION shRNA shRNA Plasmid DNA
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028640.1-3392s1c1
Sequence:CCGGGAGAGAGACTACATCGACTTTCTCGAGAAAGTCGATGTAGTCTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028640.1-2413s1c1
Sequence:CCGGGTCTGTGGATGATGTCAAATCCTCGAGGATTTGACATCATCCACAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028640.1-1618s1c1
Sequence:CCGGGTACGGCCTTGGCATTTACATCTCGAGATGTAAATGCCAAGGCCGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190767    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028640.1-3722s1c1
Sequence:CCGGGAGAGTTCACACAGACTGCTTCTCGAGAAGCAGTCTGTGTGAACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028640.1-3274s1c1
Sequence:CCGGCCATAACTGTGGACAGCTCAACTCGAGTTGAGCTGTCCACAGTTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028640.1-3564s1c1
Sequence:CCGGGCAAGCAGAAAGTCAGGTTAACTCGAGTTAACCTGACTTTCTGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028640.1-3065s1c1
Sequence:CCGGGCATCCGCTAAGAACAAGAATCTCGAGATTCTTGTTCTTAGCGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028640.1-3301s1c1
Sequence:CCGGCCACGTAATTCTGGAAGTGAACTCGAGTTCACTTCCAGAATTACGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028640
Whrn MISSION shRNA Lentiviral Transduction Particles
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028640.1-3392s1c1
Sequence:CCGGGAGAGAGACTACATCGACTTTCTCGAGAAAGTCGATGTAGTCTCTCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028640.1-2413s1c1
Sequence:CCGGGTCTGTGGATGATGTCAAATCCTCGAGGATTTGACATCATCCACAGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028640.1-1618s1c1
Sequence:CCGGGTACGGCCTTGGCATTTACATCTCGAGATGTAAATGCCAAGGCCGTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190767    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028640.1-3722s1c1
Sequence:CCGGGAGAGTTCACACAGACTGCTTCTCGAGAAGCAGTCTGTGTGAACTCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028640.1-3274s1c1
Sequence:CCGGCCATAACTGTGGACAGCTCAACTCGAGTTGAGCTGTCCACAGTTATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028640.1-3564s1c1
Sequence:CCGGGCAAGCAGAAAGTCAGGTTAACTCGAGTTAACCTGACTTTCTGCTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028640.1-3065s1c1
Sequence:CCGGGCATCCGCTAAGAACAAGAATCTCGAGATTCTTGTTCTTAGCGGATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028640.1-3301s1c1
Sequence:CCGGCCACGTAATTCTGGAAGTGAACTCGAGTTCACTTCCAGAATTACGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)