EMAIL THIS PAGE TO A FRIEND

WSCD1

WSC domain containing 1

63 Gene Product Result for
UniProtKB ID: Q658N2, A8K0N8, D3DTM3, O60276, Q96G45
Gene ID:
Mouse(216881) WSC domain containing 1
Rat(287466) WSC domain containing 1
cow(788123) WSC domain containing 1
sheep(101113774) WSC domain containing 1
naked mole-rat(101708249) WSC domain containing 1
domestic guinea pig(100722721) WSC domain containing 1
chicken(427842) WSC domain containing 1
Horse(100060919) WSC domain containing 1
dog(607122) WSC domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA015919 Anti-WSCD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177618 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177618 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177618 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015253 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015253 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015253 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074701 MISSION® esiRNA esiRNA human WSCD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015253 Rosetta Predictions human pricing
NM_001024234 Rosetta Predictions rat pricing
NM_177618 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048230 predicted 1690
2 SASI_Hs01_00048231 predicted 1948
3 SASI_Hs01_00048232 predicted 366
4 SASI_Hs01_00048233 predicted 2213
5 SASI_Hs02_00347390 predicted 1595
6 SASI_Hs01_00048234 predicted 1571
7 SASI_Hs01_00048235 predicted 2034
8 SASI_Hs01_00048236 predicted 1294
9 SASI_Hs01_00048238 predicted 1119
10 SASI_Hs01_00048239 predicted 1958
11 SASI_Hs01_00048237 predicted 1477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024234 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073886 predicted 1419
2 SASI_Rn01_00073887 predicted 810
3 SASI_Rn01_00073888 predicted 1638
4 SASI_Rn01_00073889 predicted 1766
5 SASI_Rn01_00073891 predicted 821
6 SASI_Rn01_00073892 predicted 1547
7 SASI_Rn01_00073893 predicted 2028
8 SASI_Rn01_00073894 predicted 2102
9 SASI_Rn01_00073895 predicted 2020
10 SASI_Rn02_00202365 predicted 1694
11 SASI_Rn01_00073890 predicted 1454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177618 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135349 predicted 1405
2 SASI_Mm01_00135350 predicted 1434
3 SASI_Mm01_00135351 predicted 1754
4 SASI_Mm01_00135352 predicted 2014
5 SASI_Mm01_00135353 predicted 613
6 SASI_Mm02_00347851 predicted 2019
7 SASI_Mm01_00135354 predicted 1738
8 SASI_Mm01_00135355 predicted 2086
9 SASI_Mm02_00347852 predicted 1682
10 SASI_Mm01_00135356 predicted 1766
11 SASI_Mm01_00135348 predicted 816
12 SASI_Mm01_00135357 predicted 1633
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177618
WSCD1 MISSION shRNA Bacterial Glycerol Stock
WSC domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177618.4-2363s1c2
Sequence:CCGGCCATTCTCACAGTGACCATTTCTCGAGAAATGGTCACTGTGAGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177618.4-2428s1c1
Sequence:CCGGGCTTTGCACACACAGACAAATCTCGAGATTTGTCTGTGTGTGCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177618.4-1948s1c1
Sequence:CCGGGAACAACAAAGAGGGCAGCTTCTCGAGAAGCTGCCCTCTTTGTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177618.4-1766s1c1
Sequence:CCGGCCGGAGTTTGTGAATAGCTATCTCGAGATAGCTATTCACAAACTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177618.4-433s1c1
Sequence:CCGGCAGAACACAGTTCCTGCTACTCTCGAGAGTAGCAGGAACTGTGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177618
WSCD1 MISSION shRNA shRNA Plasmid DNA
WSC domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177618.4-2363s1c2
Sequence:CCGGCCATTCTCACAGTGACCATTTCTCGAGAAATGGTCACTGTGAGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177618.4-2428s1c1
Sequence:CCGGGCTTTGCACACACAGACAAATCTCGAGATTTGTCTGTGTGTGCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177618.4-1948s1c1
Sequence:CCGGGAACAACAAAGAGGGCAGCTTCTCGAGAAGCTGCCCTCTTTGTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177618.4-1766s1c1
Sequence:CCGGCCGGAGTTTGTGAATAGCTATCTCGAGATAGCTATTCACAAACTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177618.4-433s1c1
Sequence:CCGGCAGAACACAGTTCCTGCTACTCTCGAGAGTAGCAGGAACTGTGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177618
WSCD1 MISSION shRNA Lentiviral Transduction Particles
WSC domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177618.4-2363s1c2
Sequence:CCGGCCATTCTCACAGTGACCATTTCTCGAGAAATGGTCACTGTGAGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177618.4-2428s1c1
Sequence:CCGGGCTTTGCACACACAGACAAATCTCGAGATTTGTCTGTGTGTGCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177618.4-1948s1c1
Sequence:CCGGGAACAACAAAGAGGGCAGCTTCTCGAGAAGCTGCCCTCTTTGTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177618.4-1766s1c1
Sequence:CCGGCCGGAGTTTGTGAATAGCTATCTCGAGATAGCTATTCACAAACTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177618.4-433s1c1
Sequence:CCGGCAGAACACAGTTCCTGCTACTCTCGAGAGTAGCAGGAACTGTGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015253
WSCD1 MISSION shRNA Bacterial Glycerol Stock
WSC domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000135597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015253.1-1359s1c1
Sequence:CCGGGTTCCTGCCTAACAAATCCAACTCGAGTTGGATTTGTTAGGCAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015253.1-952s1c1
Sequence:CCGGGAGTGTAACCATGAGTGCAAACTCGAGTTTGCACTCATGGTTACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135071    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015253.1-2232s1c1
Sequence:CCGGCGAACACAAATGGACACACATCTCGAGATGTGTGTCCATTTGTGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015253.1-1365s1c1
Sequence:CCGGGCCTAACAAATCCAAAGTGTTCTCGAGAACACTTTGGATTTGTTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015253.1-1328s1c1
Sequence:CCGGCTGTGCAAGACACTCGTTGTACTCGAGTACAACGAGTGTCTTGCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015253.1-1087s1c1
Sequence:CCGGCTGCCAGAGAACATCACACATCTCGAGATGTGTGATGTTCTCTGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015253.1-4597s1c1
Sequence:CCGGCGGTTAGAACAGAACAGAGAACTCGAGTTCTCTGTTCTGTTCTAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015253
WSCD1 MISSION shRNA shRNA Plasmid DNA
WSC domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000135597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015253.1-1359s1c1
Sequence:CCGGGTTCCTGCCTAACAAATCCAACTCGAGTTGGATTTGTTAGGCAGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015253.1-952s1c1
Sequence:CCGGGAGTGTAACCATGAGTGCAAACTCGAGTTTGCACTCATGGTTACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135071    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015253.1-2232s1c1
Sequence:CCGGCGAACACAAATGGACACACATCTCGAGATGTGTGTCCATTTGTGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015253.1-1365s1c1
Sequence:CCGGGCCTAACAAATCCAAAGTGTTCTCGAGAACACTTTGGATTTGTTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015253.1-1328s1c1
Sequence:CCGGCTGTGCAAGACACTCGTTGTACTCGAGTACAACGAGTGTCTTGCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015253.1-1087s1c1
Sequence:CCGGCTGCCAGAGAACATCACACATCTCGAGATGTGTGATGTTCTCTGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015253.1-4597s1c1
Sequence:CCGGCGGTTAGAACAGAACAGAGAACTCGAGTTCTCTGTTCTGTTCTAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015253
WSCD1 MISSION shRNA Lentiviral Transduction Particles
WSC domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000135597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015253.1-1359s1c1
Sequence:CCGGGTTCCTGCCTAACAAATCCAACTCGAGTTGGATTTGTTAGGCAGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015253.1-952s1c1
Sequence:CCGGGAGTGTAACCATGAGTGCAAACTCGAGTTTGCACTCATGGTTACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135071    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015253.1-2232s1c1
Sequence:CCGGCGAACACAAATGGACACACATCTCGAGATGTGTGTCCATTTGTGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015253.1-1365s1c1
Sequence:CCGGGCCTAACAAATCCAAAGTGTTCTCGAGAACACTTTGGATTTGTTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015253.1-1328s1c1
Sequence:CCGGCTGTGCAAGACACTCGTTGTACTCGAGTACAACGAGTGTCTTGCACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015253.1-1087s1c1
Sequence:CCGGCTGCCAGAGAACATCACACATCTCGAGATGTGTGATGTTCTCTGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015253.1-4597s1c1
Sequence:CCGGCGGTTAGAACAGAACAGAGAACTCGAGTTCTCTGTTCTGTTCTAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)