EMAIL THIS PAGE TO A FRIEND

XAGE3

X antigen family, member 3

27 Gene Product Result for
Synonyms: CT12.3a CT12.3b GAGED4 PLAC6 XAGE-3 pp9012
Species: Human XAGE3(170626)
UniProtKB ID: Q8WTP9, Q5JS82, Q8WYS9
Gene ID:
Human(170626) Summary: This gene is a member of the XAGE subfamily, which belongs to the GAGE family. The GAGE genes are expressed in a variety of tumors and in some fetal and reproductive tissues. This gene is expressed in placenta and fetal liver/spleen, and may function in inhibiting cancer cell growth. The protein encoded by this gene shares a sequence similarity with other GAGE/PAGE proteins. Because of the expression pattern and the sequence similarity, this protein also belongs to a family of CT (cancer-testis) antigens. Alternative splicing of this gene generates 2 transcript variants differing in the 5' UTR. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130776 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130776 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130776 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112581 MISSION® esiRNA esiRNA human XAGE3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130776 Rosetta Predictions human pricing
NM_133179 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130776 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362808 predicted 370
2 SASI_Hs02_00362809 predicted 431
3 SASI_Hs02_00362810 predicted 364
4 SASI_Hs02_00362811 predicted 128
5 SASI_Hs02_00362812 predicted 124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201561 predicted 204
2 SASI_Hs01_00201562 predicted 384
3 SASI_Hs01_00201563 predicted 444
4 SASI_Hs01_00201564 predicted 381
5 SASI_Hs01_00201565 predicted 143
6 SASI_Hs01_00201566 predicted 140
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130776
XAGE3 MISSION shRNA Bacterial Glycerol Stock
X antigen family, member 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130776.1-219s21c1
Sequence:CCGGAGAAGATCAGGGTGCAGCTGACTCGAGTCAGCTGCACCCTGATCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130776.1-97s1c1
Sequence:CCGGCCGAGGAGAAGTGTACCACCTCTCGAGAGGTGGTACACTTCTCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130776.1-133s1c1
Sequence:CCGGCCTATGCTGGAGCCCGGTGATCTCGAGATCACCGGGCTCCAGCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130776.1-299s1c1
Sequence:CCGGGTGAATGTGGAAATGGTCCTGCTCGAGCAGGACCATTTCCACATTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130776.1-144s1c1
Sequence:CCGGGCCCGGTGATGAGGAGCCTCACTCGAGTGAGGCTCCTCATCACCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130776.1-91s1c1
Sequence:CCGGCCTAGGCCGAGGAGAAGTGTACTCGAGTACACTTCTCCTCGGCCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130776
XAGE3 MISSION shRNA shRNA Plasmid DNA
X antigen family, member 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130776.1-219s21c1
Sequence:CCGGAGAAGATCAGGGTGCAGCTGACTCGAGTCAGCTGCACCCTGATCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130776.1-97s1c1
Sequence:CCGGCCGAGGAGAAGTGTACCACCTCTCGAGAGGTGGTACACTTCTCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130776.1-133s1c1
Sequence:CCGGCCTATGCTGGAGCCCGGTGATCTCGAGATCACCGGGCTCCAGCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130776.1-299s1c1
Sequence:CCGGGTGAATGTGGAAATGGTCCTGCTCGAGCAGGACCATTTCCACATTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130776.1-144s1c1
Sequence:CCGGGCCCGGTGATGAGGAGCCTCACTCGAGTGAGGCTCCTCATCACCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130776.1-91s1c1
Sequence:CCGGCCTAGGCCGAGGAGAAGTGTACTCGAGTACACTTCTCCTCGGCCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130776
XAGE3 MISSION shRNA Lentiviral Transduction Particles
X antigen family, member 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130776.1-219s21c1
Sequence:CCGGAGAAGATCAGGGTGCAGCTGACTCGAGTCAGCTGCACCCTGATCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130776.1-97s1c1
Sequence:CCGGCCGAGGAGAAGTGTACCACCTCTCGAGAGGTGGTACACTTCTCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130776.1-133s1c1
Sequence:CCGGCCTATGCTGGAGCCCGGTGATCTCGAGATCACCGGGCTCCAGCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130776.1-299s1c1
Sequence:CCGGGTGAATGTGGAAATGGTCCTGCTCGAGCAGGACCATTTCCACATTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130776.1-144s1c1
Sequence:CCGGGCCCGGTGATGAGGAGCCTCACTCGAGTGAGGCTCCTCATCACCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130776.1-91s1c1
Sequence:CCGGCCTAGGCCGAGGAGAAGTGTACTCGAGTACACTTCTCCTCGGCCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)