EMAIL THIS PAGE TO A FRIEND

ZBTB37

zinc finger and BTB domain containing 37

137 Gene Product Result for
Synonyms: D430004I08Rik ZNF908
UniProtKB ID: Q5TC79, Q5TC80, Q96M87, Q9BQ88
Gene ID:
Mouse(240869) zinc finger and BTB domain containing 37
Rat(304918) zinc finger and BTB domain containing 37
Zebrafish(568471) zinc finger and BTB domain containing 37
Horse(100061135) zinc finger and BTB domain containing 37
domestic cat(101093736) zinc finger and BTB domain containing 37
chicken(429073) zinc finger and BTB domain containing 37
dog(490336) zinc finger and BTB domain containing 37
cow(617314) zinc finger and BTB domain containing 37
sheep(101114454) zinc finger and BTB domain containing 37
naked mole-rat(101724092) zinc finger and BTB domain containing 37
Domestic Rabbit(100345509) zinc finger and BTB domain containing 37
domestic guinea pig(100724774) zinc finger and BTB domain containing 37
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032522 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032522 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032522 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173424 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173424 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173424 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122770 Rosetta Predictions human pricing
NM_032522 Rosetta Predictions human pricing
NM_001107191 Rosetta Predictions rat pricing
NM_173424 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327325 predicted 695
2 SASI_Hs02_00327326 predicted 557
3 SASI_Hs02_00327327 predicted 799
4 SASI_Hs02_00327328 predicted 453
5 SASI_Hs02_00327329 predicted 494
6 SASI_Hs02_00327330 predicted 1040
7 SASI_Hs02_00327331 predicted 983
8 SASI_Hs02_00327332 predicted 673
9 SASI_Hs02_00327333 predicted 806
10 SASI_Hs02_00327334 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360016 predicted 698
2 SASI_Hs01_00068235 predicted 555
3 SASI_Hs01_00068236 predicted 799
4 SASI_Hs01_00068237 predicted 444
5 SASI_Hs01_00068238 predicted 482
6 SASI_Hs01_00068239 predicted 1035
7 SASI_Hs02_00360017 predicted 982
8 SASI_Hs01_00068242 predicted 667
9 SASI_Hs01_00068244 predicted 802
10 SASI_Hs02_00360018 predicted 590
11 SASI_Hs01_00068240 predicted 532
12 SASI_Hs01_00068241 predicted 333
13 SASI_Hs01_00068243 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107191 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226405 predicted 1111
2 SASI_Rn02_00226406 predicted 741
3 SASI_Rn02_00226407 predicted 565
4 SASI_Rn02_00226408 predicted 764
5 SASI_Rn02_00226409 predicted 353
6 SASI_Rn02_00226410 predicted 1454
7 SASI_Rn02_00226411 predicted 611
8 SASI_Rn02_00226412 predicted 730
9 SASI_Rn02_00226413 predicted 475
10 SASI_Rn02_00226414 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345304 predicted 1588
2 SASI_Mm01_00066735 predicted 702
3 SASI_Mm01_00066736 predicted 364
4 SASI_Mm01_00066737 predicted 691
5 SASI_Mm01_00066738 predicted 1334
6 SASI_Mm01_00066739 predicted 295
7 SASI_Mm01_00066740 predicted 601
8 SASI_Mm01_00066741 predicted 1327
9 SASI_Mm01_00066742 predicted 797
10 SASI_Mm01_00066743 predicted 253
11 SASI_Mm01_00066734 predicted 516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032522
ZBTB37 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 37
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032522.3-1182s21c1
Sequence:CCGGCAGTGAAGTTGACAGATTTAGCTCGAGCTAAATCTGTCAACTTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032522.3-530s21c1
Sequence:CCGGTCTGTTACACAGGGCGGATATCTCGAGATATCCGCCCTGTGTAACAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032522.3-1296s21c1
Sequence:CCGGGGTATGGAGTTGTGGATTTAGCTCGAGCTAAATCCACAACTCCATACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032522.3-633s21c1
Sequence:CCGGGATCCTGGAGGGCATTCATTTCTCGAGAAATGAATGCCCTCCAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032522.2-1142s1c1
Sequence:CCGGGCAGTGAAGTTGACAGATTTACTCGAGTAAATCTGTCAACTTCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032522.2-818s1c1
Sequence:CCGGGCCCTCAGATCATTGAACCAACTCGAGTTGGTTCAATGATCTGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032522.2-928s1c1
Sequence:CCGGCGGAGTGATGATGAAGTTAGACTCGAGTCTAACTTCATCATCACTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032522.2-943s1c1
Sequence:CCGGGTTAGAGTTCTTGGAGCAGTACTCGAGTACTGCTCCAAGAACTCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032522.2-406s1c1
Sequence:CCGGCGGGATCACATGTCCTTGAATCTCGAGATTCAAGGACATGTGATCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032522
ZBTB37 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 37
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032522.3-1182s21c1
Sequence:CCGGCAGTGAAGTTGACAGATTTAGCTCGAGCTAAATCTGTCAACTTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032522.3-530s21c1
Sequence:CCGGTCTGTTACACAGGGCGGATATCTCGAGATATCCGCCCTGTGTAACAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032522.3-1296s21c1
Sequence:CCGGGGTATGGAGTTGTGGATTTAGCTCGAGCTAAATCCACAACTCCATACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032522.3-633s21c1
Sequence:CCGGGATCCTGGAGGGCATTCATTTCTCGAGAAATGAATGCCCTCCAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032522.2-1142s1c1
Sequence:CCGGGCAGTGAAGTTGACAGATTTACTCGAGTAAATCTGTCAACTTCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032522.2-818s1c1
Sequence:CCGGGCCCTCAGATCATTGAACCAACTCGAGTTGGTTCAATGATCTGAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032522.2-928s1c1
Sequence:CCGGCGGAGTGATGATGAAGTTAGACTCGAGTCTAACTTCATCATCACTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032522.2-943s1c1
Sequence:CCGGGTTAGAGTTCTTGGAGCAGTACTCGAGTACTGCTCCAAGAACTCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032522.2-406s1c1
Sequence:CCGGCGGGATCACATGTCCTTGAATCTCGAGATTCAAGGACATGTGATCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032522
ZBTB37 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 37
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032522.3-1182s21c1
Sequence:CCGGCAGTGAAGTTGACAGATTTAGCTCGAGCTAAATCTGTCAACTTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032522.3-530s21c1
Sequence:CCGGTCTGTTACACAGGGCGGATATCTCGAGATATCCGCCCTGTGTAACAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032522.3-1296s21c1
Sequence:CCGGGGTATGGAGTTGTGGATTTAGCTCGAGCTAAATCCACAACTCCATACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032522.3-633s21c1
Sequence:CCGGGATCCTGGAGGGCATTCATTTCTCGAGAAATGAATGCCCTCCAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032522.2-1142s1c1
Sequence:CCGGGCAGTGAAGTTGACAGATTTACTCGAGTAAATCTGTCAACTTCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032522.2-818s1c1
Sequence:CCGGGCCCTCAGATCATTGAACCAACTCGAGTTGGTTCAATGATCTGAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032522.2-928s1c1
Sequence:CCGGCGGAGTGATGATGAAGTTAGACTCGAGTCTAACTTCATCATCACTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032522.2-943s1c1
Sequence:CCGGGTTAGAGTTCTTGGAGCAGTACTCGAGTACTGCTCCAAGAACTCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032522.2-406s1c1
Sequence:CCGGCGGGATCACATGTCCTTGAATCTCGAGATTCAAGGACATGTGATCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173424
ZBTB37 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 37
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000099521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173424.1-300s1c1
Sequence:CCGGGCTCTGTGATATTGTGGTCAACTCGAGTTGACCACAATATCACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173424.1-453s1c1
Sequence:CCGGGCAACTTCTTTCTTTCTGTTACTCGAGTAACAGAAAGAAAGAAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173424.1-1230s1c1
Sequence:CCGGCCAGGTAGAAGAGTCAGCAATCTCGAGATTGCTGACTCTTCTACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173424.1-1455s1c1
Sequence:CCGGGCTGGAATATCACATCCGCAACTCGAGTTGCGGATGTGATATTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173424
ZBTB37 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 37
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000099521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173424.1-300s1c1
Sequence:CCGGGCTCTGTGATATTGTGGTCAACTCGAGTTGACCACAATATCACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173424.1-453s1c1
Sequence:CCGGGCAACTTCTTTCTTTCTGTTACTCGAGTAACAGAAAGAAAGAAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173424.1-1230s1c1
Sequence:CCGGCCAGGTAGAAGAGTCAGCAATCTCGAGATTGCTGACTCTTCTACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173424.1-1455s1c1
Sequence:CCGGGCTGGAATATCACATCCGCAACTCGAGTTGCGGATGTGATATTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173424
ZBTB37 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 37
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000099521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173424.1-300s1c1
Sequence:CCGGGCTCTGTGATATTGTGGTCAACTCGAGTTGACCACAATATCACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173424.1-453s1c1
Sequence:CCGGGCAACTTCTTTCTTTCTGTTACTCGAGTAACAGAAAGAAAGAAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173424.1-1230s1c1
Sequence:CCGGCCAGGTAGAAGAGTCAGCAATCTCGAGATTGCTGACTCTTCTACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173424.1-1455s1c1
Sequence:CCGGGCTGGAATATCACATCCGCAACTCGAGTTGCGGATGTGATATTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)