EMAIL THIS PAGE TO A FRIEND

ZDHHC8P1

zinc finger, DHHC-type containing 8 pseudogene 1

22 Gene Product Result for
Synonyms: ZDHHC8P
Species: Human ZDHHC8P1(150244)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152509 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152509 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152509 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152509 Rosetta Predictions human pricing
NR_003950 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088754 predicted 547
2 SASI_Hs01_00088755 predicted 491
3 SASI_Hs01_00088756 predicted 496
4 SASI_Hs01_00088757 predicted 680
5 SASI_Hs01_00088758 predicted 500
6 SASI_Hs01_00088759 predicted 492
7 SASI_Hs01_00088760 predicted 489
8 SASI_Hs01_00088761 predicted 501
9 SASI_Hs01_00088762 predicted 538
10 SASI_Hs01_00088763 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00380704 predicted 1038
2 SASI_Hs02_00380705 predicted 1094
3 SASI_Hs02_00380706 predicted 499
4 SASI_Hs02_00380707 predicted 1047
5 SASI_Hs02_00380708 predicted 1087
6 SASI_Hs02_00380709 predicted 1106
7 SASI_Hs02_00380710 predicted 1024
8 SASI_Hs02_00380711 predicted 1105
9 SASI_Hs02_00380712 predicted 670
10 SASI_Hs02_00380713 predicted 506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152509
ZDHHC8P1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, DHHC-type containing 8 pseudogene 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152509.1-1637s1c1
Sequence:CCGGCCTTGAGACCTGGCATTTCTTCTCGAGAAGAAATGCCAGGTCTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152509.1-942s1c1
Sequence:CCGGCAGACATCATTGTCCTCGCTTCTCGAGAAGCGAGGACAATGATGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152509.1-875s1c1
Sequence:CCGGGTGCTACAGCTCTACAGATGACTCGAGTCATCTGTAGAGCTGTAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160861    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152509.1-1643s1c1
Sequence:CCGGGACCTGGCATTTCTTTGATAACTCGAGTTATCAAAGAAATGCCAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152509.1-498s1c1
Sequence:CCGGCTGTCCTACAATAATGTGCTCCTCGAGGAGCACATTATTGTAGGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152509.1-1674s1c1
Sequence:CCGGCGTTTCCTGCTCATTCTGGAACTCGAGTTCCAGAATGAGCAGGAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152509.1-1751s1c1
Sequence:CCGGCCTTTGCTTGTAGATAAGATTCTCGAGAATCTTATCTACAAGCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152509.1-1645s1c1
Sequence:CCGGCCTGGCATTTCTTTGATAACACTCGAGTGTTATCAAAGAAATGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152509
ZDHHC8P1 MISSION shRNA shRNA Plasmid DNA
zinc finger, DHHC-type containing 8 pseudogene 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152509.1-1637s1c1
Sequence:CCGGCCTTGAGACCTGGCATTTCTTCTCGAGAAGAAATGCCAGGTCTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152509.1-942s1c1
Sequence:CCGGCAGACATCATTGTCCTCGCTTCTCGAGAAGCGAGGACAATGATGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152509.1-875s1c1
Sequence:CCGGGTGCTACAGCTCTACAGATGACTCGAGTCATCTGTAGAGCTGTAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160861    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152509.1-1643s1c1
Sequence:CCGGGACCTGGCATTTCTTTGATAACTCGAGTTATCAAAGAAATGCCAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152509.1-498s1c1
Sequence:CCGGCTGTCCTACAATAATGTGCTCCTCGAGGAGCACATTATTGTAGGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152509.1-1674s1c1
Sequence:CCGGCGTTTCCTGCTCATTCTGGAACTCGAGTTCCAGAATGAGCAGGAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152509.1-1751s1c1
Sequence:CCGGCCTTTGCTTGTAGATAAGATTCTCGAGAATCTTATCTACAAGCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152509.1-1645s1c1
Sequence:CCGGCCTGGCATTTCTTTGATAACACTCGAGTGTTATCAAAGAAATGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152509
ZDHHC8P1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, DHHC-type containing 8 pseudogene 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152509.1-1637s1c1
Sequence:CCGGCCTTGAGACCTGGCATTTCTTCTCGAGAAGAAATGCCAGGTCTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152509.1-942s1c1
Sequence:CCGGCAGACATCATTGTCCTCGCTTCTCGAGAAGCGAGGACAATGATGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152509.1-875s1c1
Sequence:CCGGGTGCTACAGCTCTACAGATGACTCGAGTCATCTGTAGAGCTGTAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160861    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152509.1-1643s1c1
Sequence:CCGGGACCTGGCATTTCTTTGATAACTCGAGTTATCAAAGAAATGCCAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152509.1-498s1c1
Sequence:CCGGCTGTCCTACAATAATGTGCTCCTCGAGGAGCACATTATTGTAGGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152509.1-1674s1c1
Sequence:CCGGCGTTTCCTGCTCATTCTGGAACTCGAGTTCCAGAATGAGCAGGAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152509.1-1751s1c1
Sequence:CCGGCCTTTGCTTGTAGATAAGATTCTCGAGAATCTTATCTACAAGCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152509.1-1645s1c1
Sequence:CCGGCCTGGCATTTCTTTGATAACACTCGAGTGTTATCAAAGAAATGCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)