EMAIL THIS PAGE TO A FRIEND

ZFAND2A

zinc finger, AN1-type domain 2A

45 Gene Product Result for
Synonyms: AIRAP
UniProtKB ID: Q8N6M9, A4D220
Gene ID:
Mouse(100494) zinc finger, AN1-type domain 2A
Rat(360772) zinc finger, AN1-type domain 2A
Zebrafish(393489) zinc finger, AN1-type domain 2A
dog(480809) zinc finger, AN1-type domain 2A
chicken(425104) zinc finger, AN1-type domain 2A
naked mole-rat(101704630) zinc finger, AN1-type domain 2A
domestic guinea pig(100733413) zinc finger, AN1-type domain 2A
cow(613974) zinc finger, AN1-type domain 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182491 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182491 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182491 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133349 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133349 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133349 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182491 Rosetta Predictions human pricing
NM_001008363 Rosetta Predictions rat pricing
NM_133349 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082718 predicted 281
2 SASI_Hs01_00082719 predicted 398
3 SASI_Hs01_00082720 predicted 565
4 SASI_Hs01_00082722 predicted 595
5 SASI_Hs01_00082723 predicted 398
6 SASI_Hs01_00082724 predicted 398
7 SASI_Hs01_00082725 predicted 575
8 SASI_Hs02_00370530 predicted 590
9 SASI_Hs01_00082726 predicted 479
10 SASI_Hs01_00082727 predicted 367
11 SASI_Hs01_00082721 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008363 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112300 predicted 877
2 SASI_Rn01_00112301 predicted 1180
3 SASI_Rn01_00112302 predicted 1193
4 SASI_Rn01_00112303 predicted 290
5 SASI_Rn01_00112304 predicted 320
6 SASI_Rn01_00112305 predicted 1094
7 SASI_Rn01_00112307 predicted 604
8 SASI_Rn02_00199131 predicted 1227
9 SASI_Rn01_00112308 predicted 329
10 SASI_Rn01_00112309 predicted 1204
11 SASI_Rn01_00112306 predicted 1150
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133349 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111133 predicted 224
2 SASI_Mm01_00111134 predicted 765
3 SASI_Mm01_00111135 predicted 445
4 SASI_Mm01_00111136 predicted 249
5 SASI_Mm01_00111137 predicted 827
6 SASI_Mm01_00111138 predicted 305
7 SASI_Mm01_00111140 predicted 816
8 SASI_Mm01_00111141 predicted 619
9 SASI_Mm02_00338528 predicted 509
10 SASI_Mm01_00111142 predicted 661
11 SASI_Mm01_00111139 predicted 548
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182491
VALIDATED
ZFAND2A MISSION shRNA Bacterial Glycerol Stock
zinc finger, AN1-type domain 2A
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182491.2-725s21c1
Sequence:CCGGATCAAAGCTGGGTGAGAAGAGCTCGAGCTCTTCTCACCCAGCTTTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182491.2-635s21c1
Sequence:CCGGCAGATGGTATGTGCCCAATGTCTCGAGACATTGGGCACATACCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182491.2-646s21c1
Sequence:CCGGTGCCCAATGTCACGGCAACTTCTCGAGAAGTTGCCGTGACATTGGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182491.1-366s1c1
Sequence:CCGGCACATAAGTGTCCGTTTGCATCTCGAGATGCAAACGGACACTTATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182491.1-407s1c1
Sequence:CCGGCCAGTATGCCCACTCTGTAATCTCGAGATTACAGAGTGGGCATACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182491.1-356s1c1
Sequence:CCGGCCATACGCTGCACATAAGTGTCTCGAGACACTTATGTGCAGCGTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182491.2-688s21c1
Sequence:CCGGTTTGGACCACAGCTGCAGACACTCGAGTGTCTGCAGCTGTGGTCCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182491.2-658s21c1
Sequence:CCAGCGGCAACTTCTGTATCCAGCACTCGAGTGCTGGATACAGAAGTTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182491.1-323s1c1
Sequence:CCGGGCATGTAAACAAGATTTCTGTCTCGAGACAGAAATCTTGTTTACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182491.1-377s1c1
Sequence:CCGGCCGTTTGCATTCCAGAAGGATCTCGAGATCCTTCTGGAATGCAAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182491.1-408s1c1
Sequence:CCGGCAGTATGCCCACTCTGTAATACTCGAGTATTACAGAGTGGGCATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182491.1-562s1c1
Sequence:CCGGGAAGAAAGAGATGCTGCAGATCTCGAGATCTGCAGCATCTCTTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182491.2-669s21c1
Sequence:CCGGGTATCCAGCACAGACACCCTTCTCGAGAAGGGTGTCTGTGCTGGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182491
VALIDATED
ZFAND2A MISSION shRNA shRNA Plasmid DNA
zinc finger, AN1-type domain 2A
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182491.2-725s21c1
Sequence:CCGGATCAAAGCTGGGTGAGAAGAGCTCGAGCTCTTCTCACCCAGCTTTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182491.2-635s21c1
Sequence:CCGGCAGATGGTATGTGCCCAATGTCTCGAGACATTGGGCACATACCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182491.2-646s21c1
Sequence:CCGGTGCCCAATGTCACGGCAACTTCTCGAGAAGTTGCCGTGACATTGGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182491.1-366s1c1
Sequence:CCGGCACATAAGTGTCCGTTTGCATCTCGAGATGCAAACGGACACTTATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182491.1-407s1c1
Sequence:CCGGCCAGTATGCCCACTCTGTAATCTCGAGATTACAGAGTGGGCATACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182491.1-356s1c1
Sequence:CCGGCCATACGCTGCACATAAGTGTCTCGAGACACTTATGTGCAGCGTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182491.2-688s21c1
Sequence:CCGGTTTGGACCACAGCTGCAGACACTCGAGTGTCTGCAGCTGTGGTCCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182491.2-658s21c1
Sequence:CCAGCGGCAACTTCTGTATCCAGCACTCGAGTGCTGGATACAGAAGTTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182491.1-323s1c1
Sequence:CCGGGCATGTAAACAAGATTTCTGTCTCGAGACAGAAATCTTGTTTACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182491.1-377s1c1
Sequence:CCGGCCGTTTGCATTCCAGAAGGATCTCGAGATCCTTCTGGAATGCAAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182491.1-408s1c1
Sequence:CCGGCAGTATGCCCACTCTGTAATACTCGAGTATTACAGAGTGGGCATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182491.1-562s1c1
Sequence:CCGGGAAGAAAGAGATGCTGCAGATCTCGAGATCTGCAGCATCTCTTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182491.2-669s21c1
Sequence:CCGGGTATCCAGCACAGACACCCTTCTCGAGAAGGGTGTCTGTGCTGGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182491
VALIDATED
ZFAND2A MISSION shRNA Lentiviral Transduction Particles
zinc finger, AN1-type domain 2A
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182491.2-725s21c1
Sequence:CCGGATCAAAGCTGGGTGAGAAGAGCTCGAGCTCTTCTCACCCAGCTTTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182491.2-635s21c1
Sequence:CCGGCAGATGGTATGTGCCCAATGTCTCGAGACATTGGGCACATACCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182491.2-646s21c1
Sequence:CCGGTGCCCAATGTCACGGCAACTTCTCGAGAAGTTGCCGTGACATTGGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182491.1-366s1c1
Sequence:CCGGCACATAAGTGTCCGTTTGCATCTCGAGATGCAAACGGACACTTATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182491.1-407s1c1
Sequence:CCGGCCAGTATGCCCACTCTGTAATCTCGAGATTACAGAGTGGGCATACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182491.1-356s1c1
Sequence:CCGGCCATACGCTGCACATAAGTGTCTCGAGACACTTATGTGCAGCGTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182491.2-688s21c1
Sequence:CCGGTTTGGACCACAGCTGCAGACACTCGAGTGTCTGCAGCTGTGGTCCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182491.2-658s21c1
Sequence:CCAGCGGCAACTTCTGTATCCAGCACTCGAGTGCTGGATACAGAAGTTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182491.1-323s1c1
Sequence:CCGGGCATGTAAACAAGATTTCTGTCTCGAGACAGAAATCTTGTTTACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182491.1-377s1c1
Sequence:CCGGCCGTTTGCATTCCAGAAGGATCTCGAGATCCTTCTGGAATGCAAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182491.1-408s1c1
Sequence:CCGGCAGTATGCCCACTCTGTAATACTCGAGTATTACAGAGTGGGCATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182491.1-562s1c1
Sequence:CCGGGAAGAAAGAGATGCTGCAGATCTCGAGATCTGCAGCATCTCTTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182491.2-669s21c1
Sequence:CCGGGTATCCAGCACAGACACCCTTCTCGAGAAGGGTGTCTGTGCTGGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133349
ZFAND2A MISSION shRNA Bacterial Glycerol Stock
zinc finger, AN1-type domain 2A
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133349.2-574s21c1
Sequence:CCGGGCATCCTCTGGACCACAATTGCTCGAGCAATTGTGGTCCAGAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133349.2-2628s21c1
Sequence:CCGGTTCCCAGCACCACCCATATTACTCGAGTAATATGGGTGGTGCTGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133349.2-431s21c1
Sequence:CCGGATGGACAGAGATTGCACCTTTCTCGAGAAAGGTGCAATCTCTGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133349.2-303s21c1
Sequence:CCGGTTTCCTACGTGGGTCATAAGTCTCGAGACTTATGACCCACGTAGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133349.2-268s21c1
Sequence:CCGGCGACGCCTGTAAACAAGATTTCTCGAGAAATCTTGTTTACAGGCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133349.2-258s1c1
Sequence:CCGGCAATAACATGCGACGCCTGTACTCGAGTACAGGCGTCGCATGTTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133349
ZFAND2A MISSION shRNA shRNA Plasmid DNA
zinc finger, AN1-type domain 2A
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133349.2-574s21c1
Sequence:CCGGGCATCCTCTGGACCACAATTGCTCGAGCAATTGTGGTCCAGAGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133349.2-2628s21c1
Sequence:CCGGTTCCCAGCACCACCCATATTACTCGAGTAATATGGGTGGTGCTGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133349.2-431s21c1
Sequence:CCGGATGGACAGAGATTGCACCTTTCTCGAGAAAGGTGCAATCTCTGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133349.2-303s21c1
Sequence:CCGGTTTCCTACGTGGGTCATAAGTCTCGAGACTTATGACCCACGTAGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133349.2-268s21c1
Sequence:CCGGCGACGCCTGTAAACAAGATTTCTCGAGAAATCTTGTTTACAGGCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133349.2-258s1c1
Sequence:CCGGCAATAACATGCGACGCCTGTACTCGAGTACAGGCGTCGCATGTTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133349
ZFAND2A MISSION shRNA Lentiviral Transduction Particles
zinc finger, AN1-type domain 2A
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133349.2-574s21c1
Sequence:CCGGGCATCCTCTGGACCACAATTGCTCGAGCAATTGTGGTCCAGAGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133349.2-2628s21c1
Sequence:CCGGTTCCCAGCACCACCCATATTACTCGAGTAATATGGGTGGTGCTGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133349.2-431s21c1
Sequence:CCGGATGGACAGAGATTGCACCTTTCTCGAGAAAGGTGCAATCTCTGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133349.2-303s21c1
Sequence:CCGGTTTCCTACGTGGGTCATAAGTCTCGAGACTTATGACCCACGTAGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133349.2-268s21c1
Sequence:CCGGCGACGCCTGTAAACAAGATTTCTCGAGAAATCTTGTTTACAGGCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133349.2-258s1c1
Sequence:CCGGCAATAACATGCGACGCCTGTACTCGAGTACAGGCGTCGCATGTTATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)