EMAIL THIS PAGE TO A FRIEND

ZNF138

zinc finger protein 138

40 Gene Product Result for
Synonyms: pHZ-32
Species: Human ZNF138(7697)
UniProtKB ID: P52744, B4DFX2, B4DP87, E9PHI7, E9PHK7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006524 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006524 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006524 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006941 MISSION® esiRNA esiRNA targeting human ZNF138 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006524 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230650 predicted 889
2 SASI_Hs01_00230651 predicted 764
3 SASI_Hs01_00230653 predicted 1094
4 SASI_Hs01_00230654 predicted 1093
5 SASI_Hs01_00230655 predicted 653
6 SASI_Hs01_00230652 predicted 760
7 SASI_Hs01_00230656 predicted 751
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006524
ZNF138 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 138
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006524.1-1437s1c1
Sequence:CCGGCCTCAACTCTTATTACACATACTCGAGTATGTGTAATAAGAGTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006524.1-760s1c1
Sequence:CCGGCTGGTCCACAAACCTTTCTAACTCGAGTTAGAAAGGTTTGTGGACCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006524.1-500s1c1
Sequence:CCGGGAACACCAAGGAGGTTATAATCTCGAGATTATAACCTCCTTGGTGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006524.1-1023s1c1
Sequence:CCGGCCCTTACTAAACATCAGATAACTCGAGTTATCTGATGTTTAGTAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006524.1-766s1c1
Sequence:CCGGCACAAACCTTTCTAAACCTAACTCGAGTTAGGTTTAGAAAGGTTTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-860s21c1
Sequence:CCGGACACTGTGGCAAAGCCTTTAACTCGAGTTAAAGGCTTTGCCACAGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-608s21c1
Sequence:CCGGAGAATGTGACAAATCACTTTGCTCGAGCAAAGTGATTTGTCACATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006524.2-1228s21c1
Sequence:CCGGAGCTCACTGAACATAAGTTAACTCGAGTTAACTTATGTTCAGTGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-251s21c1
Sequence:CCGGGCGGAATGTATATAGGCATGTCTCGAGACATGCCTATATACATTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-798s21c1
Sequence:CCGGCAATCCTCAATCCTTACTAAACTCGAGTTTAGTAAGGATTGAGGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-944s21c1
Sequence:CCGGACAATGTGGCAAGGTCTTTAACTCGAGTTAAAGACCTTGCCACATTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-635s21c1
Sequence:CCGGTTCACGCCTAACTCAACATAACTCGAGTTATGTTGAGTTAGGCGTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-892s21c1
Sequence:CCGGACCTTACTAGACATAAGATAACTCGAGTTATCTTATGTCTAGTAAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-1056s21c1
Sequence:CCGGTAACAACTTACTGAACATAAGCTCGAGCTTATGTTCAGTAAGTTGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-919s21c1
Sequence:CCGGCTGAAGAGAAACCCTACAAATCTCGAGATTTGTAGGGTTTCTCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-451s21c1
Sequence:CCGGAGGGACACCAAGGAGGTTATACTCGAGTATAACCTCCTTGGTGTCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006524
ZNF138 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 138
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006524.1-1437s1c1
Sequence:CCGGCCTCAACTCTTATTACACATACTCGAGTATGTGTAATAAGAGTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006524.1-760s1c1
Sequence:CCGGCTGGTCCACAAACCTTTCTAACTCGAGTTAGAAAGGTTTGTGGACCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006524.1-500s1c1
Sequence:CCGGGAACACCAAGGAGGTTATAATCTCGAGATTATAACCTCCTTGGTGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006524.1-1023s1c1
Sequence:CCGGCCCTTACTAAACATCAGATAACTCGAGTTATCTGATGTTTAGTAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006524.1-766s1c1
Sequence:CCGGCACAAACCTTTCTAAACCTAACTCGAGTTAGGTTTAGAAAGGTTTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-860s21c1
Sequence:CCGGACACTGTGGCAAAGCCTTTAACTCGAGTTAAAGGCTTTGCCACAGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-608s21c1
Sequence:CCGGAGAATGTGACAAATCACTTTGCTCGAGCAAAGTGATTTGTCACATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006524.2-1228s21c1
Sequence:CCGGAGCTCACTGAACATAAGTTAACTCGAGTTAACTTATGTTCAGTGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-251s21c1
Sequence:CCGGGCGGAATGTATATAGGCATGTCTCGAGACATGCCTATATACATTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-798s21c1
Sequence:CCGGCAATCCTCAATCCTTACTAAACTCGAGTTTAGTAAGGATTGAGGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-944s21c1
Sequence:CCGGACAATGTGGCAAGGTCTTTAACTCGAGTTAAAGACCTTGCCACATTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-635s21c1
Sequence:CCGGTTCACGCCTAACTCAACATAACTCGAGTTATGTTGAGTTAGGCGTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-892s21c1
Sequence:CCGGACCTTACTAGACATAAGATAACTCGAGTTATCTTATGTCTAGTAAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-1056s21c1
Sequence:CCGGTAACAACTTACTGAACATAAGCTCGAGCTTATGTTCAGTAAGTTGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-919s21c1
Sequence:CCGGCTGAAGAGAAACCCTACAAATCTCGAGATTTGTAGGGTTTCTCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-451s21c1
Sequence:CCGGAGGGACACCAAGGAGGTTATACTCGAGTATAACCTCCTTGGTGTCCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006524
ZNF138 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 138
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006524.1-1437s1c1
Sequence:CCGGCCTCAACTCTTATTACACATACTCGAGTATGTGTAATAAGAGTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006524.1-760s1c1
Sequence:CCGGCTGGTCCACAAACCTTTCTAACTCGAGTTAGAAAGGTTTGTGGACCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006524.1-500s1c1
Sequence:CCGGGAACACCAAGGAGGTTATAATCTCGAGATTATAACCTCCTTGGTGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006524.1-1023s1c1
Sequence:CCGGCCCTTACTAAACATCAGATAACTCGAGTTATCTGATGTTTAGTAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006524.1-766s1c1
Sequence:CCGGCACAAACCTTTCTAAACCTAACTCGAGTTAGGTTTAGAAAGGTTTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-860s21c1
Sequence:CCGGACACTGTGGCAAAGCCTTTAACTCGAGTTAAAGGCTTTGCCACAGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-608s21c1
Sequence:CCGGAGAATGTGACAAATCACTTTGCTCGAGCAAAGTGATTTGTCACATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006524.2-1228s21c1
Sequence:CCGGAGCTCACTGAACATAAGTTAACTCGAGTTAACTTATGTTCAGTGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-251s21c1
Sequence:CCGGGCGGAATGTATATAGGCATGTCTCGAGACATGCCTATATACATTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-798s21c1
Sequence:CCGGCAATCCTCAATCCTTACTAAACTCGAGTTTAGTAAGGATTGAGGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-944s21c1
Sequence:CCGGACAATGTGGCAAGGTCTTTAACTCGAGTTAAAGACCTTGCCACATTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-635s21c1
Sequence:CCGGTTCACGCCTAACTCAACATAACTCGAGTTATGTTGAGTTAGGCGTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-892s21c1
Sequence:CCGGACCTTACTAGACATAAGATAACTCGAGTTATCTTATGTCTAGTAAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-1056s21c1
Sequence:CCGGTAACAACTTACTGAACATAAGCTCGAGCTTATGTTCAGTAAGTTGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-919s21c1
Sequence:CCGGCTGAAGAGAAACCCTACAAATCTCGAGATTTGTAGGGTTTCTCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006524.2-451s21c1
Sequence:CCGGAGGGACACCAAGGAGGTTATACTCGAGTATAACCTCCTTGGTGTCCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)