EMAIL THIS PAGE TO A FRIEND

ZNF212

zinc finger protein 212

58 Gene Product Result for
Synonyms: C2H2-150 ZNF182 ZNFC150
UniProtKB ID: Q9UDV6, B2RCF4, Q13396, Q8N664
Gene ID:
Human(7988) Summary: This gene belongs to the C2H2-type zinc finger gene family. The zinc finger proteins are involved in gene regulation and development, and are quite conserved throughout evolution. Like this gene product, a third of the zinc finger proteins containing C2H2 fingers also contain the KRAB domain, which has been found to be involved in protein-protein interactions. [provided by RefSeq, Jul 2008]
cow(507268) zinc finger protein 212
sheep(101107860) zinc finger protein 212
domestic guinea pig(100734654) zinc finger protein 212
naked mole-rat(101696936) zinc finger protein 212
domestic cat(101088319) zinc finger protein 212
Horse(100060933) zinc finger protein 212
dog(482785) zinc finger protein 212
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012256 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012256 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012256 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012256 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012256 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121861 predicted 590
2 SASI_Hs01_00121862 predicted 1055
3 SASI_Hs02_00343968 predicted 230
4 SASI_Hs01_00121863 predicted 1034
5 SASI_Hs01_00121864 predicted 1055
6 SASI_Hs01_00121865 predicted 1471
7 SASI_Hs01_00121866 predicted 1299
8 SASI_Hs01_00121867 predicted 665
9 SASI_Hs01_00121868 predicted 791
10 SASI_Hs01_00121869 predicted 1378
11 SASI_Hs01_00121870 predicted 231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012256
VALIDATED
ZNF212 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 212
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012256.2-741s21c1
Sequence:CCGGGATCAAACAGGAGCTACAGTACTCGAGTACTGTAGCTCCTGTTTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012256.2-599s21c1
Sequence:CCGGACGTGATGGAGAGTAACTATGCTCGAGCATAGTTACTCTCCATCACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012256.2-526s21c1
Sequence:CCGGGAGAATGATGGCGTCTGTTTCCTCGAGGAAACAGACGCCATCATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012256.2-663s21c1
Sequence:CCGGAGCGGAGTTGGGTACAGAGATCTCGAGATCTCTGTACCCAACTCCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012256.2-907s21c1
Sequence:CCGGGAGGAGCCTGTTGGTAGTAGACTCGAGTCTACTACCAACAGGCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012256.2-2365s1c1
Sequence:CCGGCCAGTGAAGTTGCTGATGGTACTCGAGTACCATCAGCAACTTCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012256.2-787s1c1
Sequence:CCGGCCTGGAGAGTTCTCATGCATTCTCGAGAATGCATGAGAACTCTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_012256.2-1044s1c1
Sequence:CCGGCGAATGTTCTGAGTGTGAGATCTCGAGATCTCACACTCAGAACATTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_012256.2-137s1c1
Sequence:CCGGGCTCCACACCTTTAACTTCTTCTCGAGAAGAAGTTAAAGGTGTGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_012256.2-1368s1c1
Sequence:CCGGGAGTTCCCTCATCTGTGGTTACTCGAGTAACCACAGATGAGGGAACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012256.2-1296s21c1
Sequence:CCGGGCATGTCCAAGAGAGGTTCTCCTCGAGGAGAACCTCTCTTGGACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012256.2-1709s21c1
Sequence:CCGGAGTACCAAGCCAAGCCCAAAGCTCGAGCTTTGGGCTTGGCTTGGTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012256.2-1962s21c1
Sequence:CCGGGAAGAGTTCTGGGAAGTATAACTCGAGTTATACTTCCCAGAACTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012256
VALIDATED
ZNF212 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 212
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012256.2-741s21c1
Sequence:CCGGGATCAAACAGGAGCTACAGTACTCGAGTACTGTAGCTCCTGTTTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012256.2-599s21c1
Sequence:CCGGACGTGATGGAGAGTAACTATGCTCGAGCATAGTTACTCTCCATCACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012256.2-526s21c1
Sequence:CCGGGAGAATGATGGCGTCTGTTTCCTCGAGGAAACAGACGCCATCATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012256.2-663s21c1
Sequence:CCGGAGCGGAGTTGGGTACAGAGATCTCGAGATCTCTGTACCCAACTCCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012256.2-907s21c1
Sequence:CCGGGAGGAGCCTGTTGGTAGTAGACTCGAGTCTACTACCAACAGGCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012256.2-2365s1c1
Sequence:CCGGCCAGTGAAGTTGCTGATGGTACTCGAGTACCATCAGCAACTTCACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012256.2-787s1c1
Sequence:CCGGCCTGGAGAGTTCTCATGCATTCTCGAGAATGCATGAGAACTCTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_012256.2-1044s1c1
Sequence:CCGGCGAATGTTCTGAGTGTGAGATCTCGAGATCTCACACTCAGAACATTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_012256.2-137s1c1
Sequence:CCGGGCTCCACACCTTTAACTTCTTCTCGAGAAGAAGTTAAAGGTGTGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_012256.2-1368s1c1
Sequence:CCGGGAGTTCCCTCATCTGTGGTTACTCGAGTAACCACAGATGAGGGAACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012256.2-1296s21c1
Sequence:CCGGGCATGTCCAAGAGAGGTTCTCCTCGAGGAGAACCTCTCTTGGACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012256.2-1709s21c1
Sequence:CCGGAGTACCAAGCCAAGCCCAAAGCTCGAGCTTTGGGCTTGGCTTGGTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012256.2-1962s21c1
Sequence:CCGGGAAGAGTTCTGGGAAGTATAACTCGAGTTATACTTCCCAGAACTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012256
VALIDATED
ZNF212 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 212
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012256.2-741s21c1
Sequence:CCGGGATCAAACAGGAGCTACAGTACTCGAGTACTGTAGCTCCTGTTTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012256.2-599s21c1
Sequence:CCGGACGTGATGGAGAGTAACTATGCTCGAGCATAGTTACTCTCCATCACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012256.2-526s21c1
Sequence:CCGGGAGAATGATGGCGTCTGTTTCCTCGAGGAAACAGACGCCATCATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012256.2-663s21c1
Sequence:CCGGAGCGGAGTTGGGTACAGAGATCTCGAGATCTCTGTACCCAACTCCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012256.2-907s21c1
Sequence:CCGGGAGGAGCCTGTTGGTAGTAGACTCGAGTCTACTACCAACAGGCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012256.2-2365s1c1
Sequence:CCGGCCAGTGAAGTTGCTGATGGTACTCGAGTACCATCAGCAACTTCACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012256.2-787s1c1
Sequence:CCGGCCTGGAGAGTTCTCATGCATTCTCGAGAATGCATGAGAACTCTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_012256.2-1044s1c1
Sequence:CCGGCGAATGTTCTGAGTGTGAGATCTCGAGATCTCACACTCAGAACATTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_012256.2-137s1c1
Sequence:CCGGGCTCCACACCTTTAACTTCTTCTCGAGAAGAAGTTAAAGGTGTGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_012256.2-1368s1c1
Sequence:CCGGGAGTTCCCTCATCTGTGGTTACTCGAGTAACCACAGATGAGGGAACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012256.2-1296s21c1
Sequence:CCGGGCATGTCCAAGAGAGGTTCTCCTCGAGGAGAACCTCTCTTGGACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012256.2-1709s21c1
Sequence:CCGGAGTACCAAGCCAAGCCCAAAGCTCGAGCTTTGGGCTTGGCTTGGTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012256.2-1962s21c1
Sequence:CCGGGAAGAGTTCTGGGAAGTATAACTCGAGTTATACTTCCCAGAACTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)