EMAIL THIS PAGE TO A FRIEND

ZNF224

zinc finger protein 224

20 Gene Product Result for
Synonyms: BMZF-2 BMZF2 KOX22 ZNF255 ZNF27
Species: Human ZNF224(7767)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013398 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013398 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013398 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013398 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219022 predicted 736
2 SASI_Hs01_00219023 predicted 711
3 SASI_Hs01_00219026 predicted 1185
4 SASI_Hs01_00219027 predicted 644
5 SASI_Hs01_00219028 predicted 447
6 SASI_Hs01_00219025 predicted 1033
7 SASI_Hs02_00344767 predicted 708
8 SASI_Hs01_00219029 predicted 1536
9 SASI_Hs02_00344768 predicted 2353
10 SASI_Hs01_00219024 predicted 751
11 SASI_Hs01_00219030 predicted 1911
12 SASI_Hs01_00219031 predicted 516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013398
ZNF224 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 224
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013398.1-642s21c1
Sequence:CCGGTCTCAAGACTTGGTGATAAATCTCGAGATTTATCACCAAGTCTTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013398.1-744s21c1
Sequence:CCGGTCCCAGGGCAATGGATATAAACTCGAGTTTATATCCATTGCCCTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013398.1-1251s21c1
Sequence:CCGGCGATGTGATACGTGTGATAAGCTCGAGCTTATCACACGTATCACATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013398.1-671s21c1
Sequence:CCGGGTTCTCCAAAGAAGGTGATTTCTCGAGAAATCACCTTCTTTGGAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013398.1-1364s21c1
Sequence:CCGGTTGTAGGCGAGATCTTTATACCTCGAGGTATAAAGATCTCGCCTACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013398.1-641s1c1
Sequence:CCGGGTCTCAAGACTTGGTGATAAACTCGAGTTTATCACCAAGTCTTGAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013398.1-2158s1c1
Sequence:CCGGGCAGAGAAACACCTCTCAAATCTCGAGATTTGAGAGGTGTTTCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013398.1-1250s1c1
Sequence:CCGGCCGATGTGATACGTGTGATAACTCGAGTTATCACACGTATCACATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013398.1-1768s1c1
Sequence:CCGGGTGGGAAGAGATTTACTCAAACTCGAGTTTGAGTAAATCTCTTCCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013398.1-752s1c1
Sequence:CCGGCAATGGATATAAACCATCCTTCTCGAGAAGGATGGTTTATATCCATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013398
ZNF224 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 224
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013398.1-642s21c1
Sequence:CCGGTCTCAAGACTTGGTGATAAATCTCGAGATTTATCACCAAGTCTTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013398.1-744s21c1
Sequence:CCGGTCCCAGGGCAATGGATATAAACTCGAGTTTATATCCATTGCCCTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013398.1-1251s21c1
Sequence:CCGGCGATGTGATACGTGTGATAAGCTCGAGCTTATCACACGTATCACATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013398.1-671s21c1
Sequence:CCGGGTTCTCCAAAGAAGGTGATTTCTCGAGAAATCACCTTCTTTGGAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013398.1-1364s21c1
Sequence:CCGGTTGTAGGCGAGATCTTTATACCTCGAGGTATAAAGATCTCGCCTACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013398.1-641s1c1
Sequence:CCGGGTCTCAAGACTTGGTGATAAACTCGAGTTTATCACCAAGTCTTGAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013398.1-2158s1c1
Sequence:CCGGGCAGAGAAACACCTCTCAAATCTCGAGATTTGAGAGGTGTTTCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013398.1-1250s1c1
Sequence:CCGGCCGATGTGATACGTGTGATAACTCGAGTTATCACACGTATCACATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013398.1-1768s1c1
Sequence:CCGGGTGGGAAGAGATTTACTCAAACTCGAGTTTGAGTAAATCTCTTCCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013398.1-752s1c1
Sequence:CCGGCAATGGATATAAACCATCCTTCTCGAGAAGGATGGTTTATATCCATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013398
ZNF224 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 224
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013398.1-642s21c1
Sequence:CCGGTCTCAAGACTTGGTGATAAATCTCGAGATTTATCACCAAGTCTTGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013398.1-744s21c1
Sequence:CCGGTCCCAGGGCAATGGATATAAACTCGAGTTTATATCCATTGCCCTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013398.1-1251s21c1
Sequence:CCGGCGATGTGATACGTGTGATAAGCTCGAGCTTATCACACGTATCACATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013398.1-671s21c1
Sequence:CCGGGTTCTCCAAAGAAGGTGATTTCTCGAGAAATCACCTTCTTTGGAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013398.1-1364s21c1
Sequence:CCGGTTGTAGGCGAGATCTTTATACCTCGAGGTATAAAGATCTCGCCTACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013398.1-641s1c1
Sequence:CCGGGTCTCAAGACTTGGTGATAAACTCGAGTTTATCACCAAGTCTTGAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013398.1-2158s1c1
Sequence:CCGGGCAGAGAAACACCTCTCAAATCTCGAGATTTGAGAGGTGTTTCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013398.1-1250s1c1
Sequence:CCGGCCGATGTGATACGTGTGATAACTCGAGTTATCACACGTATCACATCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013398.1-1768s1c1
Sequence:CCGGGTGGGAAGAGATTTACTCAAACTCGAGTTTGAGTAAATCTCTTCCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013398.1-752s1c1
Sequence:CCGGCAATGGATATAAACCATCCTTCTCGAGAAGGATGGTTTATATCCATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)