EMAIL THIS PAGE TO A FRIEND

ZNF230

zinc finger protein 230

20 Gene Product Result for
Synonyms: FDZF2
Species: Human ZNF230(7773)
UniProtKB ID: Q9UIE0, O15322, Q504X7, Q86W84, Q9P1U6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006300 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006300 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006300 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006300 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176580 predicted 942
2 SASI_Hs01_00176581 predicted 1165
3 SASI_Hs01_00176582 predicted 550
4 SASI_Hs01_00176583 predicted 943
5 SASI_Hs01_00176584 predicted 655
6 SASI_Hs01_00176585 predicted 1374
7 SASI_Hs01_00176586 predicted 870
8 SASI_Hs01_00176587 predicted 1532
9 SASI_Hs01_00176588 predicted 1538
10 SASI_Hs02_00341314 predicted 1561
11 SASI_Hs01_00176589 predicted 1463
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006300
VALIDATED
ZNF230 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 230
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_006300.1-1167s1c1
Sequence:CCGGGCTTCACTGATAGCCTAGATTCTCGAGAATCTAGGCTATCAGTGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006300.1-1686s1c1
Sequence:CCGGGTGTATATAATACGTAATGATCTCGAGATCATTACGTATTATATACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006300.1-1598s1c1
Sequence:CCGGCGCTTGAATCTGGATATAATTCTCGAGAATTATATCCAGATTCAAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006300.1-364s1c1
Sequence:CCGGGCATCAACCATTCCACCCTTTCTCGAGAAAGGGTGGAATGGTTGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006300.1-790s1c1
Sequence:CCGGCTTGAGAGAGAAACTCTCTAACTCGAGTTAGAGAGTTTCTCTCTCAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006300.3-475s21c1
Sequence:CCGGATTCAGGCGGCAAGACTATTGCTCGAGCAATAGTCTTGCCGCCTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006300.3-2048s21c1
Sequence:CCGGCTTACCTTGCTTAGCTTATATCTCGAGATATAAGCTAAGCAAGGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006300.3-822s21c1
Sequence:GTACCGGTTGAGAGAGAAACTCTCTAAGCTCGAGCTTAGAGAGTTTCTCTCTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006300.3-565s21c1
Sequence:CCGGAGTCTCAAGACTCCATCATAACTCGAGTTATGATGGAGTCTTGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006300.3-1533s21c1
Sequence:CCGGAGGCTTGTACACCGGTCTTTCCTCGAGGAAAGACCGGTGTACAAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006300
VALIDATED
ZNF230 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 230
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_006300.1-1167s1c1
Sequence:CCGGGCTTCACTGATAGCCTAGATTCTCGAGAATCTAGGCTATCAGTGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006300.1-1686s1c1
Sequence:CCGGGTGTATATAATACGTAATGATCTCGAGATCATTACGTATTATATACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006300.1-1598s1c1
Sequence:CCGGCGCTTGAATCTGGATATAATTCTCGAGAATTATATCCAGATTCAAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006300.1-364s1c1
Sequence:CCGGGCATCAACCATTCCACCCTTTCTCGAGAAAGGGTGGAATGGTTGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006300.1-790s1c1
Sequence:CCGGCTTGAGAGAGAAACTCTCTAACTCGAGTTAGAGAGTTTCTCTCTCAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006300.3-475s21c1
Sequence:CCGGATTCAGGCGGCAAGACTATTGCTCGAGCAATAGTCTTGCCGCCTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006300.3-2048s21c1
Sequence:CCGGCTTACCTTGCTTAGCTTATATCTCGAGATATAAGCTAAGCAAGGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006300.3-822s21c1
Sequence:GTACCGGTTGAGAGAGAAACTCTCTAAGCTCGAGCTTAGAGAGTTTCTCTCTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006300.3-565s21c1
Sequence:CCGGAGTCTCAAGACTCCATCATAACTCGAGTTATGATGGAGTCTTGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006300.3-1533s21c1
Sequence:CCGGAGGCTTGTACACCGGTCTTTCCTCGAGGAAAGACCGGTGTACAAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006300
VALIDATED
ZNF230 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 230
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_006300.1-1167s1c1
Sequence:CCGGGCTTCACTGATAGCCTAGATTCTCGAGAATCTAGGCTATCAGTGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006300.1-1686s1c1
Sequence:CCGGGTGTATATAATACGTAATGATCTCGAGATCATTACGTATTATATACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006300.1-1598s1c1
Sequence:CCGGCGCTTGAATCTGGATATAATTCTCGAGAATTATATCCAGATTCAAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006300.1-364s1c1
Sequence:CCGGGCATCAACCATTCCACCCTTTCTCGAGAAAGGGTGGAATGGTTGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006300.1-790s1c1
Sequence:CCGGCTTGAGAGAGAAACTCTCTAACTCGAGTTAGAGAGTTTCTCTCTCAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006300.3-475s21c1
Sequence:CCGGATTCAGGCGGCAAGACTATTGCTCGAGCAATAGTCTTGCCGCCTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006300.3-2048s21c1
Sequence:CCGGCTTACCTTGCTTAGCTTATATCTCGAGATATAAGCTAAGCAAGGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006300.3-822s21c1
Sequence:GTACCGGTTGAGAGAGAAACTCTCTAAGCTCGAGCTTAGAGAGTTTCTCTCTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006300.3-565s21c1
Sequence:CCGGAGTCTCAAGACTCCATCATAACTCGAGTTATGATGGAGTCTTGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006300.3-1533s21c1
Sequence:CCGGAGGCTTGTACACCGGTCTTTCCTCGAGGAAAGACCGGTGTACAAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)