EMAIL THIS PAGE TO A FRIEND

ZNF234

zinc finger protein 234

18 Gene Product Result for
Synonyms: HZF4 ZNF269
UniProtKB ID: Q14588, A8K1C8, Q96IR4, Q9NS45, Q9NYT7
Gene ID:
dog(484242) zinc finger protein 234
Horse(100629690) zinc finger protein 234
cow(789917) zinc finger protein 234
sheep(101109992) zinc finger protein 234
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006630 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006630 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006630 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110001 MISSION® esiRNA esiRNA human ZNF234 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006630 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006630 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109968 predicted 556
2 SASI_Hs01_00109969 predicted 1289
3 SASI_Hs01_00109970 predicted 1309
4 SASI_Hs01_00109971 predicted 1288
5 SASI_Hs01_00109972 predicted 1805
6 SASI_Hs01_00109973 predicted 1113
7 SASI_Hs01_00109974 predicted 615
8 SASI_Hs01_00109975 predicted 1536
9 SASI_Hs01_00109976 predicted 1200
10 SASI_Hs01_00109977 predicted 1287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006630
ZNF234 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 234
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006630.2-2869s21c1
Sequence:CCGGACAGTAGCATTCTCTTATTTACTCGAGTAAATAAGAGAATGCTACTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006630.2-2439s21c1
Sequence:CCGGCAACCTGAATGCTTGTAATTACTCGAGTAATTACAAGCATTCAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006630.1-966s1c1
Sequence:CCGGCGTAGATCAACACTTACTGTACTCGAGTACAGTAAGTGTTGATCTACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006630.1-1813s1c1
Sequence:CCGGCGCATCTTCTAACCCATCAGACTCGAGTCTGATGGGTTAGAAGATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006630.1-1305s1c1
Sequence:CCGGCCTTCACAATTTCAGGCCCATCTCGAGATGGGCCTGAAATTGTGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006630.1-1041s1c1
Sequence:CCGGGCCTTCATACATGCTTCCCATCTCGAGATGGGAAGCATGTATGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006630.1-1355s1c1
Sequence:CCGGCGTATGTAAAGTGTGTGGTAACTCGAGTTACCACACACTTTACATACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006630
ZNF234 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 234
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006630.2-2869s21c1
Sequence:CCGGACAGTAGCATTCTCTTATTTACTCGAGTAAATAAGAGAATGCTACTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006630.2-2439s21c1
Sequence:CCGGCAACCTGAATGCTTGTAATTACTCGAGTAATTACAAGCATTCAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006630.1-966s1c1
Sequence:CCGGCGTAGATCAACACTTACTGTACTCGAGTACAGTAAGTGTTGATCTACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006630.1-1813s1c1
Sequence:CCGGCGCATCTTCTAACCCATCAGACTCGAGTCTGATGGGTTAGAAGATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006630.1-1305s1c1
Sequence:CCGGCCTTCACAATTTCAGGCCCATCTCGAGATGGGCCTGAAATTGTGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006630.1-1041s1c1
Sequence:CCGGGCCTTCATACATGCTTCCCATCTCGAGATGGGAAGCATGTATGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006630.1-1355s1c1
Sequence:CCGGCGTATGTAAAGTGTGTGGTAACTCGAGTTACCACACACTTTACATACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006630
ZNF234 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 234
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006630.2-2869s21c1
Sequence:CCGGACAGTAGCATTCTCTTATTTACTCGAGTAAATAAGAGAATGCTACTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006630.2-2439s21c1
Sequence:CCGGCAACCTGAATGCTTGTAATTACTCGAGTAATTACAAGCATTCAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006630.1-966s1c1
Sequence:CCGGCGTAGATCAACACTTACTGTACTCGAGTACAGTAAGTGTTGATCTACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006630.1-1813s1c1
Sequence:CCGGCGCATCTTCTAACCCATCAGACTCGAGTCTGATGGGTTAGAAGATGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006630.1-1305s1c1
Sequence:CCGGCCTTCACAATTTCAGGCCCATCTCGAGATGGGCCTGAAATTGTGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006630.1-1041s1c1
Sequence:CCGGGCCTTCATACATGCTTCCCATCTCGAGATGGGAAGCATGTATGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006630.1-1355s1c1
Sequence:CCGGCGTATGTAAAGTGTGTGGTAACTCGAGTTACCACACACTTTACATACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)