EMAIL THIS PAGE TO A FRIEND

ZNF23

zinc finger protein 23

21 Gene Product Result for
Synonyms: KOX16 ZNF359 ZNF612 Zfp612
UniProtKB ID: P17027, Q96IT3, Q9UG42
Gene ID:
dog(489720) zinc finger protein 23
naked mole-rat(101697696) zinc finger protein 23
domestic guinea pig(100724207) zinc finger protein 23
cow(781790) zinc finger protein 23
sheep(101105180) zinc finger protein 23
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145911 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145911 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145911 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145911 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170303 predicted 1199
2 SASI_Hs01_00170304 predicted 1518
3 SASI_Hs01_00170305 predicted 958
4 SASI_Hs02_00365448 predicted 2513
5 SASI_Hs01_00170307 predicted 2093
6 SASI_Hs01_00170308 predicted 2350
7 SASI_Hs01_00170309 predicted 2022
8 SASI_Hs01_00170310 predicted 2432
9 SASI_Hs01_00170311 predicted 1664
10 SASI_Hs01_00170312 predicted 1319
11 SASI_Hs01_00170306 predicted 1338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145911
ZNF23 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 23
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145911.1-2645s21c1
Sequence:CCGGACTTGGAAGAAACCCTATATGCTCGAGCATATAGGGTTTCTTCCAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145911.1-2175s21c1
Sequence:CCGGGAAAGGCCTTCAGCGTTAATGCTCGAGCATTAACGCTGAAGGCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145911.1-3110s1c1
Sequence:CCGGGCCTTGTTGTTGGATAGGAAACTCGAGTTTCCTATCCAACAACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145911.1-1325s1c1
Sequence:CCGGGAAGAATTAGTAGAGCCCTTTCTCGAGAAAGGGCTCTACTAATTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145911.1-1681s1c1
Sequence:CCGGCAGCTGTAGTTCTGCATATATCTCGAGATATATGCAGAACTACAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145911.1-2517s1c1
Sequence:CCGGCCTTCCATGTTAATGCCCATTCTCGAGAATGGGCATTAACATGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145911.1-2348s1c1
Sequence:CCGGGCCTTCAGTATCAATGCCAAACTCGAGTTTGGCATTGATACTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145911
ZNF23 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 23
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145911.1-2645s21c1
Sequence:CCGGACTTGGAAGAAACCCTATATGCTCGAGCATATAGGGTTTCTTCCAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145911.1-2175s21c1
Sequence:CCGGGAAAGGCCTTCAGCGTTAATGCTCGAGCATTAACGCTGAAGGCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145911.1-3110s1c1
Sequence:CCGGGCCTTGTTGTTGGATAGGAAACTCGAGTTTCCTATCCAACAACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145911.1-1325s1c1
Sequence:CCGGGAAGAATTAGTAGAGCCCTTTCTCGAGAAAGGGCTCTACTAATTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145911.1-1681s1c1
Sequence:CCGGCAGCTGTAGTTCTGCATATATCTCGAGATATATGCAGAACTACAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145911.1-2517s1c1
Sequence:CCGGCCTTCCATGTTAATGCCCATTCTCGAGAATGGGCATTAACATGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145911.1-2348s1c1
Sequence:CCGGGCCTTCAGTATCAATGCCAAACTCGAGTTTGGCATTGATACTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145911
ZNF23 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 23
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145911.1-2645s21c1
Sequence:CCGGACTTGGAAGAAACCCTATATGCTCGAGCATATAGGGTTTCTTCCAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145911.1-2175s21c1
Sequence:CCGGGAAAGGCCTTCAGCGTTAATGCTCGAGCATTAACGCTGAAGGCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145911.1-3110s1c1
Sequence:CCGGGCCTTGTTGTTGGATAGGAAACTCGAGTTTCCTATCCAACAACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145911.1-1325s1c1
Sequence:CCGGGAAGAATTAGTAGAGCCCTTTCTCGAGAAAGGGCTCTACTAATTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145911.1-1681s1c1
Sequence:CCGGCAGCTGTAGTTCTGCATATATCTCGAGATATATGCAGAACTACAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145911.1-2517s1c1
Sequence:CCGGCCTTCCATGTTAATGCCCATTCTCGAGAATGGGCATTAACATGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145911.1-2348s1c1
Sequence:CCGGGCCTTCAGTATCAATGCCAAACTCGAGTTTGGCATTGATACTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)