EMAIL THIS PAGE TO A FRIEND

ZNF300

zinc finger protein 300

42 Gene Product Result for
Gene ID:
Human(91975) Summary: The protein encoded by this gene is a C2H2-type zinc finger DNA binding protein and likely transcriptional regulator. The function of this protein is not yet known. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
dog(489183) zinc finger protein 300
domestic guinea pig(100736053) zinc finger protein 300
cow(524256) zinc finger protein 300
sheep(101111022) zinc finger protein 300
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052860 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052860 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052860 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052860 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077358 predicted 2110
2 SASI_Hs01_00077360 predicted 618
3 SASI_Hs02_00361555 predicted 1229
4 SASI_Hs01_00077362 predicted 799
5 SASI_Hs01_00077363 predicted 1179
6 SASI_Hs02_00361556 predicted 1681
7 SASI_Hs01_00077364 predicted 1609
8 SASI_Hs01_00077365 predicted 518
9 SASI_Hs01_00077366 predicted 477
10 SASI_Hs01_00077367 predicted 1613
11 SASI_Hs01_00077359 predicted 468
12 SASI_Hs01_00077361 predicted 1192
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052860
VALIDATED
ZNF300 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 300
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052860.1-2765s1c1
Sequence:CCGGCCTCACAGATTGTGTGACTTTCTCGAGAAAGTCACACAATCTGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052860.1-502s1c1
Sequence:CCGGCCAGATGAATATCAGGCAGATCTCGAGATCTGCCTGATATTCATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_052860.1-1096s1c1
Sequence:CCGGGCCTTTGCTAAGAAGTCACAACTCGAGTTGTGACTTCTTAGCAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052860.1-1180s1c1
Sequence:CCGGGCCTTCAGTGAGAAGTTTCATCTCGAGATGAAACTTCTCACTGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_052860.1-945s1c1
Sequence:CCGGGCCCAATTCTAATCTTGAGAACTCGAGTTCTCAAGATTAGAATTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052860
VALIDATED
ZNF300 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 300
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052860.1-2765s1c1
Sequence:CCGGCCTCACAGATTGTGTGACTTTCTCGAGAAAGTCACACAATCTGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052860.1-502s1c1
Sequence:CCGGCCAGATGAATATCAGGCAGATCTCGAGATCTGCCTGATATTCATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_052860.1-1096s1c1
Sequence:CCGGGCCTTTGCTAAGAAGTCACAACTCGAGTTGTGACTTCTTAGCAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052860.1-1180s1c1
Sequence:CCGGGCCTTCAGTGAGAAGTTTCATCTCGAGATGAAACTTCTCACTGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_052860.1-945s1c1
Sequence:CCGGGCCCAATTCTAATCTTGAGAACTCGAGTTCTCAAGATTAGAATTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052860
VALIDATED
ZNF300 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 300
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052860.1-2765s1c1
Sequence:CCGGCCTCACAGATTGTGTGACTTTCTCGAGAAAGTCACACAATCTGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052860.1-502s1c1
Sequence:CCGGCCAGATGAATATCAGGCAGATCTCGAGATCTGCCTGATATTCATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_052860.1-1096s1c1
Sequence:CCGGGCCTTTGCTAAGAAGTCACAACTCGAGTTGTGACTTCTTAGCAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052860.1-1180s1c1
Sequence:CCGGGCCTTCAGTGAGAAGTTTCATCTCGAGATGAAACTTCTCACTGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_052860.1-945s1c1
Sequence:CCGGGCCCAATTCTAATCTTGAGAACTCGAGTTCTCAAGATTAGAATTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)