EMAIL THIS PAGE TO A FRIEND

ZNF330

zinc finger protein 330

60 Gene Product Result for
Synonyms: HSA6591 NOA36
UniProtKB ID: Q9Y3S2, B2RDA3
Gene ID:
Zebrafish(406682) zinc finger protein 330
chicken(422453) zinc finger protein 330
dog(476073) zinc finger protein 330
domestic cat(101089260) zinc finger protein 330
naked mole-rat(101717185) zinc finger protein 330
domestic guinea pig(100731960) zinc finger protein 330
cow(533230) zinc finger protein 330
sheep(101113532) zinc finger protein 330
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014487 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014487 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014487 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057461 MISSION® esiRNA esiRNA human ZNF330 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014487 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103317 predicted 450
2 SASI_Hs01_00103318 predicted 711
3 SASI_Hs02_00345736 predicted 547
4 SASI_Hs01_00103319 predicted 496
5 SASI_Hs01_00103321 predicted 418
6 SASI_Hs01_00103322 predicted 700
7 SASI_Hs01_00103323 predicted 395
8 SASI_Hs01_00103324 predicted 415
9 SASI_Hs01_00103325 predicted 401
10 SASI_Hs01_00103326 predicted 544
11 SASI_Hs01_00103320 predicted 1417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014487
VALIDATED
ZNF330 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 330
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000135651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014487.2-404s1c1
Sequence:CCGGGAAGTCTTCAGACTGTGTCATCTCGAGATGACACAGTCTGAAGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014487.2-1617s1c1
Sequence:CCGGCATGTCACCTTGAGTTGTCATCTCGAGATGACAACTCAAGGTGACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014487.2-1240s1c1
Sequence:CCGGGCAGAAGACTAGTTACACTTACTCGAGTAAGTGTAACTAGTCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014487.2-468s1c1
Sequence:CCGGGCAATATGTGACTTCTGTGAACTCGAGTTCACAGAAGTCACATATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133903    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014487.2-1188s1c1
Sequence:CCGGCTTGATGAATTGTGTGTGGTTCTCGAGAACCACACACAATTCATCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014487.2-756s1c1
Sequence:CCGGGATGATCATACAAGGAGCAAACTCGAGTTTGCTCCTTGTATGATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014487.2-1115s1c1
Sequence:CCGGCTATGAGGAACAAGAGAACTACTCGAGTAGTTCTCTTGTTCCTCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014487.2-1045s1c1
Sequence:CCGGCAGATACTGAGTCATCAGATTCTCGAGAATCTGATGACTCAGTATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014487.2-912s1c1
Sequence:CCGGGCTTCTGGGTATGATGCTTATCTCGAGATAAGCATCATACCCAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014487.2-824s1c1
Sequence:CCGGGCATGAAACTCAGGAGACTAACTCGAGTTAGTCTCCTGAGTTTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014487
VALIDATED
ZNF330 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 330
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000135651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014487.2-404s1c1
Sequence:CCGGGAAGTCTTCAGACTGTGTCATCTCGAGATGACACAGTCTGAAGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014487.2-1617s1c1
Sequence:CCGGCATGTCACCTTGAGTTGTCATCTCGAGATGACAACTCAAGGTGACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014487.2-1240s1c1
Sequence:CCGGGCAGAAGACTAGTTACACTTACTCGAGTAAGTGTAACTAGTCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014487.2-468s1c1
Sequence:CCGGGCAATATGTGACTTCTGTGAACTCGAGTTCACAGAAGTCACATATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133903    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014487.2-1188s1c1
Sequence:CCGGCTTGATGAATTGTGTGTGGTTCTCGAGAACCACACACAATTCATCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014487.2-756s1c1
Sequence:CCGGGATGATCATACAAGGAGCAAACTCGAGTTTGCTCCTTGTATGATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014487.2-1115s1c1
Sequence:CCGGCTATGAGGAACAAGAGAACTACTCGAGTAGTTCTCTTGTTCCTCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014487.2-1045s1c1
Sequence:CCGGCAGATACTGAGTCATCAGATTCTCGAGAATCTGATGACTCAGTATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014487.2-912s1c1
Sequence:CCGGGCTTCTGGGTATGATGCTTATCTCGAGATAAGCATCATACCCAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014487.2-824s1c1
Sequence:CCGGGCATGAAACTCAGGAGACTAACTCGAGTTAGTCTCCTGAGTTTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014487
VALIDATED
ZNF330 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 330
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000135651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014487.2-404s1c1
Sequence:CCGGGAAGTCTTCAGACTGTGTCATCTCGAGATGACACAGTCTGAAGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014487.2-1617s1c1
Sequence:CCGGCATGTCACCTTGAGTTGTCATCTCGAGATGACAACTCAAGGTGACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014487.2-1240s1c1
Sequence:CCGGGCAGAAGACTAGTTACACTTACTCGAGTAAGTGTAACTAGTCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014487.2-468s1c1
Sequence:CCGGGCAATATGTGACTTCTGTGAACTCGAGTTCACAGAAGTCACATATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133903    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014487.2-1188s1c1
Sequence:CCGGCTTGATGAATTGTGTGTGGTTCTCGAGAACCACACACAATTCATCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014487.2-756s1c1
Sequence:CCGGGATGATCATACAAGGAGCAAACTCGAGTTTGCTCCTTGTATGATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014487.2-1115s1c1
Sequence:CCGGCTATGAGGAACAAGAGAACTACTCGAGTAGTTCTCTTGTTCCTCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014487.2-1045s1c1
Sequence:CCGGCAGATACTGAGTCATCAGATTCTCGAGAATCTGATGACTCAGTATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014487.2-912s1c1
Sequence:CCGGGCTTCTGGGTATGATGCTTATCTCGAGATAAGCATCATACCCAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014487.2-824s1c1
Sequence:CCGGGCATGAAACTCAGGAGACTAACTCGAGTTAGTCTCCTGAGTTTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)