EMAIL THIS PAGE TO A FRIEND

ZNF441

zinc finger protein 441

17 Gene Product Result for
Species: Human ZNF441(126068)
UniProtKB ID: Q8N8Z8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152355 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152355 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152355 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152355 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067265 predicted 1450
2 SASI_Hs01_00067266 predicted 952
3 SASI_Hs01_00067267 predicted 864
4 SASI_Hs01_00067268 predicted 2029
5 SASI_Hs01_00067269 predicted 539
6 SASI_Hs01_00067270 predicted 2262
7 SASI_Hs01_00067271 predicted 2283
8 SASI_Hs01_00067272 predicted 946
9 SASI_Hs01_00067273 predicted 1792
10 SASI_Hs01_00067274 predicted 595
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152355
ZNF441 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 441
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152355.2-2319s21c1
Sequence:CCGGTACTTTCAGCTTCTTACAAATCTCGAGATTTGTAAGAAGCTGAAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152355.2-2190s21c1
Sequence:CCGGAGTATGGAGAAACCCTATAAGCTCGAGCTTATAGGGTTTCTCCATACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152355.2-791s21c1
Sequence:CCGGGTTGTGTGGAAACGCCTTTATCTCGAGATAAAGGCGTTTCCACACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152355.2-766s21c1
Sequence:CCGGATGGAGATGGACCTCGTATATCTCGAGATATACGAGGTCCATCTCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152355.1-1532s1c1
Sequence:CCGGCTTCAGGTCTTCCAATTACATCTCGAGATGTAATTGGAAGACCTGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152355.1-880s1c1
Sequence:CCGGCCACTCTAAGACATGAAAGAACTCGAGTTCTTTCATGTCTTAGAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152355.1-628s1c1
Sequence:CCGGCCTGCTTTCAAATACATGAAACTCGAGTTTCATGTATTTGAAAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152355.1-2041s1c1
Sequence:CCGGGTCATTCAAGTTACTTACGAACTCGAGTTCGTAAGTAACTTGAATGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152355.1-867s1c1
Sequence:CCGGCCTGCTTATAGTTCCACTCTACTCGAGTAGAGTGGAACTATAAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152355
ZNF441 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 441
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152355.2-2319s21c1
Sequence:CCGGTACTTTCAGCTTCTTACAAATCTCGAGATTTGTAAGAAGCTGAAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152355.2-2190s21c1
Sequence:CCGGAGTATGGAGAAACCCTATAAGCTCGAGCTTATAGGGTTTCTCCATACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152355.2-791s21c1
Sequence:CCGGGTTGTGTGGAAACGCCTTTATCTCGAGATAAAGGCGTTTCCACACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152355.2-766s21c1
Sequence:CCGGATGGAGATGGACCTCGTATATCTCGAGATATACGAGGTCCATCTCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152355.1-1532s1c1
Sequence:CCGGCTTCAGGTCTTCCAATTACATCTCGAGATGTAATTGGAAGACCTGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152355.1-880s1c1
Sequence:CCGGCCACTCTAAGACATGAAAGAACTCGAGTTCTTTCATGTCTTAGAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152355.1-628s1c1
Sequence:CCGGCCTGCTTTCAAATACATGAAACTCGAGTTTCATGTATTTGAAAGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152355.1-2041s1c1
Sequence:CCGGGTCATTCAAGTTACTTACGAACTCGAGTTCGTAAGTAACTTGAATGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152355.1-867s1c1
Sequence:CCGGCCTGCTTATAGTTCCACTCTACTCGAGTAGAGTGGAACTATAAGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152355
ZNF441 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 441
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152355.2-2319s21c1
Sequence:CCGGTACTTTCAGCTTCTTACAAATCTCGAGATTTGTAAGAAGCTGAAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152355.2-2190s21c1
Sequence:CCGGAGTATGGAGAAACCCTATAAGCTCGAGCTTATAGGGTTTCTCCATACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152355.2-791s21c1
Sequence:CCGGGTTGTGTGGAAACGCCTTTATCTCGAGATAAAGGCGTTTCCACACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152355.2-766s21c1
Sequence:CCGGATGGAGATGGACCTCGTATATCTCGAGATATACGAGGTCCATCTCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152355.1-1532s1c1
Sequence:CCGGCTTCAGGTCTTCCAATTACATCTCGAGATGTAATTGGAAGACCTGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152355.1-880s1c1
Sequence:CCGGCCACTCTAAGACATGAAAGAACTCGAGTTCTTTCATGTCTTAGAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152355.1-628s1c1
Sequence:CCGGCCTGCTTTCAAATACATGAAACTCGAGTTTCATGTATTTGAAAGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152355.1-2041s1c1
Sequence:CCGGGTCATTCAAGTTACTTACGAACTCGAGTTCGTAAGTAACTTGAATGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152355.1-867s1c1
Sequence:CCGGCCTGCTTATAGTTCCACTCTACTCGAGTAGAGTGGAACTATAAGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)