EMAIL THIS PAGE TO A FRIEND

ZNF532

zinc finger protein 532

132 Gene Product Result for
UniProtKB ID: Q9HCE3, Q4G0V6, Q7L7Z7, Q96QR7, Q9NVJ6
Gene ID:
Zebrafish(559908) zinc finger protein 532
chicken(426851) zinc finger protein 532
Horse(100054713) zinc finger protein 532
domestic cat(101101510) zinc finger protein 532
dog(476187) zinc finger protein 532
chicken(426345) zinc finger protein 532
cow(533847) zinc finger protein 532
sheep(101123432) zinc finger protein 532
naked mole-rat(101719079) zinc finger protein 532
domestic guinea pig(100713211) zinc finger protein 532
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA015322 Anti-ZNF532 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018181 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018181 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018181 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085581 MISSION® esiRNA esiRNA human ZNF532 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018181 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021080 predicted 3472
2 SASI_Hs01_00021081 predicted 3159
3 SASI_Hs01_00021082 predicted 2709
4 SASI_Hs02_00351440 predicted 590
5 SASI_Hs01_00021083 predicted 3390
6 SASI_Hs01_00021084 predicted 3770
7 SASI_Hs01_00021085 predicted 3829
8 SASI_Hs02_00351441 predicted 3433
9 SASI_Hs01_00021087 predicted 1163
10 SASI_Hs01_00021088 predicted 1970
11 SASI_Hs01_00021086 predicted 2783
12 SASI_Hs01_00021089 predicted 951
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018181
VALIDATED
ZNF532 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 532
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018181.3-4316s1c1
Sequence:CCGGCGGAAGTTGGAAGAACCAGTTCTCGAGAACTGGTTCTTCCAACTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018181.3-4447s1c1
Sequence:CCGGGCTGCAATTCCACGAACACATCTCGAGATGTGTTCGTGGAATTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018181.3-1749s1c1
Sequence:CCGGGCAAAGAACCAGTGGCCAATTCTCGAGAATTGGCCACTGGTTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_018181.3-1654s1c1
Sequence:CCGGCGTTGCGCCATCAAAGACAAACTCGAGTTTGTCTTTGATGGCGCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_018181.3-1081s1c1
Sequence:CCGGCGTCAAGAATGTTCGGAACATCTCGAGATGTTCCGAACATTCTTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018181.3-950s1c1
Sequence:CCGGCCAGATATGGTCGATCCTAAACTCGAGTTTAGGATCGACCATATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018181.3-3733s1c1
Sequence:CCGGGCAACTTATGATGGACCATATCTCGAGATATGGTCCATCATAAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018181.3-2523s1c1
Sequence:CCGGCCAAACCTCAGCAACAAATAACTCGAGTTATTTGTTGCTGAGGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018181.4-1971s21c1
Sequence:CCGGCGGTGAAAGCCACGGTCATATCTCGAGATATGACCGTGGCTTTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_018181.4-2571s21c1
Sequence:GTACCGGTGCAATGCTCCCACTTAATTTCTCGAGAAATTAAGTGGGAGCATTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018181.4-5867s21c1
Sequence:CCGGTATGCACTCCATCCATCATAACTCGAGTTATGATGGATGGAGTGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018181.4-5867s1c1
Sequence:CCGGTATGCACTCCATCCATCATAACTCGAGTTATGATGGATGGAGTGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219826    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018181.4-6257s1c1
Sequence:CCGGAGGCCACATAGGTCCGAATAACTCGAGTTATTCGGACCTATGTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018181.4-3448s21c1
Sequence:CCGGGCCTCCAAACTTGGGTATAAACTCGAGTTTATACCCAAGTTTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_018181.4-3167s21c1
Sequence:CCGGATTTGTCCAATGGCGTTTAAGCTCGAGCTTAAACGCCATTGGACAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018181
VALIDATED
ZNF532 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 532
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018181.3-4316s1c1
Sequence:CCGGCGGAAGTTGGAAGAACCAGTTCTCGAGAACTGGTTCTTCCAACTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018181.3-4447s1c1
Sequence:CCGGGCTGCAATTCCACGAACACATCTCGAGATGTGTTCGTGGAATTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018181.3-1749s1c1
Sequence:CCGGGCAAAGAACCAGTGGCCAATTCTCGAGAATTGGCCACTGGTTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_018181.3-1654s1c1
Sequence:CCGGCGTTGCGCCATCAAAGACAAACTCGAGTTTGTCTTTGATGGCGCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_018181.3-1081s1c1
Sequence:CCGGCGTCAAGAATGTTCGGAACATCTCGAGATGTTCCGAACATTCTTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018181.3-950s1c1
Sequence:CCGGCCAGATATGGTCGATCCTAAACTCGAGTTTAGGATCGACCATATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018181.3-3733s1c1
Sequence:CCGGGCAACTTATGATGGACCATATCTCGAGATATGGTCCATCATAAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018181.3-2523s1c1
Sequence:CCGGCCAAACCTCAGCAACAAATAACTCGAGTTATTTGTTGCTGAGGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018181.4-1971s21c1
Sequence:CCGGCGGTGAAAGCCACGGTCATATCTCGAGATATGACCGTGGCTTTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_018181.4-2571s21c1
Sequence:GTACCGGTGCAATGCTCCCACTTAATTTCTCGAGAAATTAAGTGGGAGCATTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018181.4-5867s21c1
Sequence:CCGGTATGCACTCCATCCATCATAACTCGAGTTATGATGGATGGAGTGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018181.4-5867s1c1
Sequence:CCGGTATGCACTCCATCCATCATAACTCGAGTTATGATGGATGGAGTGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219826    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018181.4-6257s1c1
Sequence:CCGGAGGCCACATAGGTCCGAATAACTCGAGTTATTCGGACCTATGTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018181.4-3448s21c1
Sequence:CCGGGCCTCCAAACTTGGGTATAAACTCGAGTTTATACCCAAGTTTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_018181.4-3167s21c1
Sequence:CCGGATTTGTCCAATGGCGTTTAAGCTCGAGCTTAAACGCCATTGGACAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018181
VALIDATED
ZNF532 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 532
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018181.3-4316s1c1
Sequence:CCGGCGGAAGTTGGAAGAACCAGTTCTCGAGAACTGGTTCTTCCAACTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018181.3-4447s1c1
Sequence:CCGGGCTGCAATTCCACGAACACATCTCGAGATGTGTTCGTGGAATTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018181.3-1749s1c1
Sequence:CCGGGCAAAGAACCAGTGGCCAATTCTCGAGAATTGGCCACTGGTTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_018181.3-1654s1c1
Sequence:CCGGCGTTGCGCCATCAAAGACAAACTCGAGTTTGTCTTTGATGGCGCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_018181.3-1081s1c1
Sequence:CCGGCGTCAAGAATGTTCGGAACATCTCGAGATGTTCCGAACATTCTTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018181.3-950s1c1
Sequence:CCGGCCAGATATGGTCGATCCTAAACTCGAGTTTAGGATCGACCATATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018181.3-3733s1c1
Sequence:CCGGGCAACTTATGATGGACCATATCTCGAGATATGGTCCATCATAAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018181.3-2523s1c1
Sequence:CCGGCCAAACCTCAGCAACAAATAACTCGAGTTATTTGTTGCTGAGGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018181.4-1971s21c1
Sequence:CCGGCGGTGAAAGCCACGGTCATATCTCGAGATATGACCGTGGCTTTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_018181.4-2571s21c1
Sequence:GTACCGGTGCAATGCTCCCACTTAATTTCTCGAGAAATTAAGTGGGAGCATTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018181.4-5867s21c1
Sequence:CCGGTATGCACTCCATCCATCATAACTCGAGTTATGATGGATGGAGTGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018181.4-5867s1c1
Sequence:CCGGTATGCACTCCATCCATCATAACTCGAGTTATGATGGATGGAGTGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219826    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018181.4-6257s1c1
Sequence:CCGGAGGCCACATAGGTCCGAATAACTCGAGTTATTCGGACCTATGTGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018181.4-3448s21c1
Sequence:CCGGGCCTCCAAACTTGGGTATAAACTCGAGTTTATACCCAAGTTTGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_018181.4-3167s21c1
Sequence:CCGGATTTGTCCAATGGCGTTTAAGCTCGAGCTTAAACGCCATTGGACAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)